-
Notifications
You must be signed in to change notification settings - Fork 14
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Allow collision of samples with warning only, custom ordered headers …
- Loading branch information
Showing
4 changed files
with
146 additions
and
43 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,66 @@ | ||
[Header],,,,,,,,,, | ||
IEMFileVersion,5,,,,,,,,, | ||
Experiment Name,Tsqn180801,,,,,,,,, | ||
Date,3/08/2018,,,,,,,,, | ||
Workflow,GenerateFASTQ,,,,,,,,, | ||
Application,NovaSeq FASTQ Only,,,,,,,,, | ||
Instrument Type,NovaSeq,,,,,,,,, | ||
Assay,TruSeq Nano DNA,,,,,,,,, | ||
Index Adapters,IDT-ILMN TruSeq DNA UD Indexes (96 Indexes),,,,,,,,, | ||
Description,Tsqn180801,,,,,,,,, | ||
Chemistry,Amplicon,,,,,,,,, | ||
,,,,,,,,,, | ||
[Reads],,,,,,,,,, | ||
151,,,,,,,,,, | ||
151,,,,,,,,,, | ||
,,,,,,,,,, | ||
[Settings],,,,,,,,,, | ||
Adapter,AGATCGGAAGAGCACACGTCTGAACTCCAGTCA,,,,,,,,, | ||
AdapterRead2,AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT,,,,,,,,, | ||
,,,,,,,,,, | ||
[Data],,,,,,,,,, | ||
Sample_ID,Sample_Name,Sample_Plate,Sample_Well,Index_Plate_Well,I7_Index_ID,index,I5_Index_ID,index2,Sample_Project,Description | ||
PRJ180538_VPH20T,,,,,SI-GA-G6_1,CTGACGCG,,,, | ||
PRJ180538_VPH20T,,,,,SI-GA-G6_2,GGTCGTAC,,,, | ||
PRJ180538_VPH20T,,,,,SI-GA-G6_3,TCCTTCTT,,,, | ||
PRJ180538_VPH20T,,,,,SI-GA-G6_4,AAAGAAGA,,,, | ||
PRJ180539_VCBPH5T,,,,,SI-GA-G7_1,GGTATGCA,,,, | ||
PRJ180539_VCBPH5T,,,,,SI-GA-G7_2,CTCGAAAT,,,, | ||
PRJ180539_VCBPH5T,,,,,SI-GA-G7_3,ACACCTTC,,,, | ||
PRJ180539_VCBPH5T,,,,,SI-GA-G7_4,TAGTGCGG,,,, | ||
PRJ180540_VCBP14T,,,,,SI-GA-G8_1,TATGAGCT,,,, | ||
PRJ180540_VCBP14T,,,,,SI-GA-G8_2,CCGATAGC,,,, | ||
PRJ180540_VCBP14T,,,,,SI-GA-G8_3,ATACCCAA,,,, | ||
PRJ180540_VCBP14T,,,,,SI-GA-G8_4,GGCTGTTG,,,, | ||
PRJ180541_VPH8T,,,,,SI-GA-G9_1,TAGGACGT,,,, | ||
PRJ180541_VPH8T,,,,,SI-GA-G9_2,ATCCCACA,,,, | ||
PRJ180541_VPH8T,,,,,SI-GA-G9_3,GGAATGTC,,,, | ||
PRJ180541_VPH8T,,,,,SI-GA-G9_4,CCTTGTAG,,,, | ||
PRJ180542_VPH23T,,,,,SI-GA-G10_1,TCGCCAGC,,,, | ||
PRJ180542_VPH23T,,,,,SI-GA-G10_2,AATGTTAG,,,, | ||
PRJ180542_VPH23T,,,,,SI-GA-G10_3,CGATAGCT,,,, | ||
PRJ180542_VPH23T,,,,,SI-GA-G10_4,GTCAGCTA,,,, | ||
PRJ180543_VPH36T,,,,,SI-GA-G11_1,TTATCGTT,,,, | ||
PRJ180543_VPH36T,,,,,SI-GA-G11_2,AGCAGAGC,,,, | ||
PRJ180543_VPH36T,,,,,SI-GA-G11_3,CATCTCCA,,,, | ||
PRJ180543_VPH36T,,,,,SI-GA-G11_4,GCGGATAG,,,, | ||
PRJ180544_PGL3,,,,,SI-GA-G12_1,ATTCTAAG,,,, | ||
PRJ180544_PGL3,,,,,SI-GA-G12_2,CCCGATTA,,,, | ||
PRJ180544_PGL3,,,,,SI-GA-G12_3,TGGAGGCT,,,, | ||
PRJ180544_PGL3,,,,,SI-GA-G12_4,GAATCCGC,,,, | ||
PRJ180545_LSI_noIAA,,,,,SI-GA-F3_1,TTCAGGTG,,,, | ||
PRJ180545_LSI_noIAA,,,,,SI-GA-F3_2,ACGGACAT,,,, | ||
PRJ180545_LSI_noIAA,,,,,SI-GA-F3_3,GATCTTGA,,,, | ||
PRJ180545_LSI_noIAA,,,,,SI-GA-F3_4,CGATCACC,,,, | ||
PRJ180546_LSI_IAA,,,,,SI-GA-F4_1,CCCAATAG,,,, | ||
PRJ180546_LSI_IAA,,,,,SI-GA-F4_2,GTGTCGCT,,,, | ||
PRJ180546_LSI_IAA,,,,,SI-GA-F4_3,AGAGTCGC,,,, | ||
PRJ180546_LSI_IAA,,,,,SI-GA-F4_4,TATCGATA,,,, | ||
PRJ180547_LL_30,,,,,SI-GA-F1_1,GTTGCAGC,,,, | ||
PRJ180547_LL_30,,,,,SI-GA-F1_2,TGGAATTA,,,, | ||
PRJ180547_LL_30,,,,,SI-GA-F1_3,CAATGGAG,,,, | ||
PRJ180547_LL_30,,,,,SI-GA-F1_4,ACCCTCCT,,,, | ||
PRJ180548_LL_38,,,,,SI-GA-F2_1,TTTACATG,,,, | ||
PRJ180548_LL_38,,,,,SI-GA-F2_2,CGCGATAC,,,, | ||
PRJ180548_LL_38,,,,,SI-GA-F2_3,ACGCGGGT,,,, | ||
PRJ180548_LL_38,,,,,SI-GA-F2_4,GAATTCCA,,,, |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters