Merge pull request #505 from GavinHuttley/develop

BUG: hypothesis_result.select_models handles nested codon models, fixes #504

src/cogent3/app/result.py

@@ -467,8 +467,13 @@ def select_models(self, stat="aicc", threshold=0.05):
         assert stat in ("aicc", "aic")
         second_order = stat == "aicc"
         results = []
-        for k, m in self.items():
-            val = m.lf.get_aic(second_order=second_order)
+        for m in self.values():
+            if isinstance(m.lf, dict):
+                # multiple lf's, e.g. split codon position analyses have 3
+                val = sum(lf.get_aic(second_order=second_order) for lf in m.lf.values())
+            else:
+                val = m.lf.get_aic(second_order=second_order)
+
             results.append((val, m))
         results.sort()
         min_model = results.pop(0)

tests/test_app/test_evo.py

@@ -319,6 +319,22 @@ def test_null_hyp_fail_error(self):
         r = hyp(aln)
         self.assertEqual(r.origin, "model")
 
+    def test_hyp_split_codon_select_models(self):
+        """hypothesis_result identifies selects best model when split_codon"""
+        _data = {
+            "Human": "ATGCGGCTCGCGGAGGCCGCGCTCGCGGAG",
+            "Mouse": "ATGCCCGGCGCCAAGGCAGCGCTGGCGGAG",
+            "Opossum": "ATGCCAGTGAAAGTGGCGGCGGTGGCTGAG",
+        }
+        aln = make_aligned_seqs(data=_data, moltype="dna")
+        opt_args = dict(max_evaluations=10, limit_action="ignore")
+        m1 = evo_app.model("F81", split_codons=True, opt_args=opt_args)
+        m2 = evo_app.model("GTR", split_codons=True, opt_args=opt_args)
+        hyp = evo_app.hypothesis(m1, m2)
+        r = hyp(aln)
+        bm = r.select_models()
+        assert_allclose(bm[0].lnL, -85.00043312185628)
+
     def test_alt_hyp_fail_error(self):
         """if alt fails NotCompleted.origin should be model"""
         _data = {