Merge pull request #495 from GavinHuttley/develop

app.evo model and hypothesis consistency checks and tests

src/cogent3/app/evo.py

@@ -203,6 +203,14 @@ def _fit_aln(
         return lf
 
     def fit(self, aln, initialise=None, construct=True, **opt_args):
+        moltypes = {aln.moltype.label, self._sm.moltype.label}
+        if moltypes == {"protein", "dna"} or moltypes == {"protein", "rna"}:
+            msg = (
+                f"substitution model moltype '{self._sm.moltype.label}' and"
+                f" alignment moltype '{aln.moltype.label}' are incompatible"
+            )
+            return NotCompleted("ERROR", self, msg, source=aln)
+
         evaluation_limit = opt_args.get("max_evaluations", None)
         if self._tree is None:
             assert len(aln.names) == 3
@@ -295,11 +303,21 @@ def test_hypothesis(self, aln):
         except ValueError as err:
             msg = f"Hypothesis null had bounds error {aln.info.source}"
             return NotCompleted("ERROR", self, msg, source=aln)
+
+        if not null:
+            return null
+
         try:
             alts = [alt for alt in self._initialised_alt_from_null(null, aln)]
         except ValueError as err:
             msg = f"Hypothesis alt had bounds error {aln.info.source}"
             return NotCompleted("ERROR", self, msg, source=aln)
+
+        # check if any did not complete
+        for alt in alts:
+            if not alt:
+                return alt
+
         results = {alt.name: alt for alt in alts}
         results.update({null.name: null})
 

tests/test_app/test_evo.py

@@ -283,6 +283,50 @@ def test_select_model(self):
         expect = set(hyp.values())
         self.assertEqual(set(got), expect)
 
+    def test_null_hyp_fail_error(self):
+        """if null fails NotCompleted.origin should be model"""
+        _data = {
+            "Human": "ATGCGGCTCGCGGAGGCCGCGCTCGCGGAG",
+            "Mouse": "ATGCCCGGCGCCAAGGCAGCGCTGGCGGAG",
+            "Opossum": "ATGCCAGTGAAAGTGGCGGCGGTGGCTGAG",
+        }
+        aln = make_aligned_seqs(data=_data, moltype="dna")
+        tree = "((Mouse,Rat),Human,Opossum)"
+        m1 = evo_app.model("F81", tree=tree)
+        m2 = evo_app.model("GTR", tree=tree)
+        hyp = evo_app.hypothesis(m1, m2)
+        r = hyp(aln)
+        self.assertEqual(r.origin, "model")
+
+    def test_alt_hyp_fail_error(self):
+        """if alt fails NotCompleted.origin should be model"""
+        _data = {
+            "Human": "ATGCGGCTCGCGGAGGCCGCGCTCGCGGA",
+            "Mouse": "ATGCCCGGCGCCAAGGCAGCGCTGGCGGA",
+            "Opossum": "TGACCAGTGAAAGTGGCGGCGGTGGCTGA",
+        }
+        aln = make_aligned_seqs(data=_data, moltype="dna")
+        tree = "(Mouse,Human,Opossum)"
+        m1 = evo_app.model("F81", tree=tree)
+        m2 = evo_app.model("MG94HKY", tree=tree)
+        hyp = evo_app.hypothesis(m1, m2)
+        r = hyp(aln)
+        self.assertEqual(r.origin, "model")
+
+    def test_model_moltype_mismatch(self):
+        """if model and alignment moltypes incompatible"""
+        _data = {
+            "Human": "ATGCGGCTCGCGGAGGCCGCGCTCGCGGA",
+            "Mouse": "ATGCCCGGCGCCAAGGCAGCGCTGGCGGA",
+            "Opossum": "TGACCAGTGAAAGTGGCGGCGGTGGCTGA",
+        }
+        aln = make_aligned_seqs(data=_data, moltype="dna")
+        tree = "(Mouse,Human,Opossum)"
+        m1 = evo_app.model("JTT92", tree=tree)
+        r = m1(aln)
+        print(r)
+        self.assertEqual(r.origin, "model")
+
 
 class TestAncestralStates(TestCase):
     def test_ancestral(self):