#CRISPR Analyser

##Summary This module is a collection of C++ scripts that has the primary function of finding off targets for a CRISPR site as quick as possible, for any species. This is achieved by:

1. Creating an index of every CRISPR site within the target genome
2. Loading that index into memory (requires 2.4GB~ memory for Human)
3. Brute force checking the specified site against every possible CRISPR site

For memory efficiency the index only contains a unique id and sequence, so is only really useful if you create a database to run along side the analyser. You can see ours here:

http://www.sanger.ac.uk/htgt/wge/

The code for the website is on github:

https://github.com/htgt/WGE

It would also be possible to have a databaseless website by modifying the crispr index to include a start position and chromosome, then just have a javascript page that drives the server.

If you have any issues/feature requests please create an issue on github. If you use the code or our website in any scientific work please cite:

Bin Shen, Wensheng Zhang, Jun Zhang, Jiankui Zhou, Jianying Wang, Li Chen, Lu Wang, Alex Hodgkins, Vivek Iyer, Xingxu Huang & William C Skarnes (2014) Efficient genome modification by CRISPR-Cas9 nickase with minimal off-target effects. doi:10.1038/nmeth.2857

##Speed The initial load time of the index will depend entirely on the speed of the disk you store it on. An index will be 2-3gb which is all loaded into memory; for us this usually takes about 5 seconds per index. This is quite high if you are searching for a single CRISPR at a time, so generally I recommend using the server so you only have to load the index once.

Once the application has loaded all the CRISPRs into memory it usually takes 2-4 seconds to find all off targets with up to 4 mismatches for a gRNA. The program can be easily modified to check for more than 4 mismatches, but it was not feasible for us to store off targets with any more than 4 mismatches in our database.

##Database You will want to create a postgres database to store the actual CRISPR data, here is our CRISPR table:

CREATE TABLE crisprs (
    id SERIAL PRIMARY KEY,
    chr_name text NOT NULL,
    chr_start integer NOT NULL,
    seq text NOT NULL,
    pam_right boolean NOT NULL,
    species_id integer NOT NULL,
    off_target_ids integer[],
    off_target_summary text,
);

To have multiple species you should leave this is a parent table with no rows, and make a child table for each species, e.g.:

CREATE TABLE crisprs_human (
    CHECK ((species_id = 1))
)
INHERITS (crisprs);

You will also want some indexes/constraints:

ALTER TABLE ONLY crisprs_mouse ADD CONSTRAINT crisprs_mouse_unique_loci UNIQUE (chr_start, chr_name, pam_right);
CREATE INDEX idx_crisprs_mouse_loci ON crisprs_mouse USING btree (chr_name, chr_start);

If you are using inheritance each timeyou add a new species crispr table you need to add a primary key:

alter table crisprs_dog add constraint crisprs_dog_pkey primary key (id);

Or finding a CRISPR by ID will run incredibly slowly.

You can see how to populate this table in the next section

##Build The actual build step is very simple, and simply requires running make:

git clone https://github.com/htgt/CRISPR-Analyser.git
cd CRISPR-Analyser
make

But before the program can be used you must create an index:

###Find all CRISPRs within the genome This has now been integrated into the crispr_analyser under the 'gather' command. Run './bin/crispr_analyser gather' to see all possible options

This step produces a .csv of all CRISPRs in a given genome, which can be run directly into a psql copy statement to quickly add rows to a table. The output .csv file is used in the next step to generate the index. Once the index has been created and the rows inserted into your database this file can be deleted.

The step can be run like so:

./bin/crispr_analyser gather -i ~/Homo_sapiens.GRCh38_15.fa -o ~/GRCh38_crisprs.csv -e 1

Where -e is the species id that you will set in your database, -i is the input genome in fasta format, and -o is where you want to output the csv. If you don't know what the species id should be it's probably 1.

You can then load this into your database in psql:

\copy crisprs_human(chr_name, chr_start, seq, pam_right, species_id) from '~/GRCh38_crisprs.csv' with delimiter ',';

and now you can create an index:

###Create index Once you have generated the csv file(s) above you can give them to the crispr_analyser index command with the -i flag:

./bin/crispr_analyser index -i ~/GRCh38_crisprs.csv -o /lustre/scratch109/sanger/ah19/GRCh38_crisprs.bin -s Human -a GRCh37 -e 1

Note: the -i flag can be set multiple times to read from many input files

The other options:

 -i    The input files
 -o    The file to output the binary index to
 -s    The species name 
 -e    The species ID in your database
 -a    The assembly

You can now skip to the usage section unless you want to use more than 1 species

Note: Each CRISPR in the index sits inside a 64bit integer, 40 bits are used to store the CRISPR and a single bit is used to store the strand (what we call pam_right). This leaves 23 bits in which you could store additional information about the crispr if you so chose (but I would recommend leaving at least 1 bit untouched because invalid crisprs are marked with all 64 bits set to 1.

#####Indexing a second species If you are storing the CRISPRs in a database, all CRISPRs must have a unique ID so to add a second species you must add one more flag:

 -f    The offset that your database IDs begin with

For example, to add the second species you should start the CRISPR ids in your database at 300,000,001 and set -f to 300,000,000:

./bin/crispr_analyser index -i /lustre/scratch109/sanger/ah19/mouse_first_10_fixed.tsv -i /lustre/scratch109/sanger/ah19/mouse_after_10_fixed.tsv -o /lustre/scratch109/sanger/ah19/GRCm38_index.bin -s Mouse -a GRCm38 -e 2 -f 300000000

Meaning 300,000,000 should be subtracted from whatever ID is given to get a species localised ID, as 300,000,001 here corresponds to Mouse CRISPR 1

##Usage

###Retrieve an ID given a gRNA You can find all possible ids for a given gRNA with the search command:

./bin/crispr_analyser search -i /lustre/scratch109/sanger/ah19/crispr_indexes/GRCh37_index.bin -s GTGTCAGTGAAACTTACTCT

Which outputs:

Loaded 298539596 sequences
Loading took 2.230000 seconds
Found 1 exact matches
Scanning took 0.840000 seconds
Found the following matches:
	245377736

###Find off targets Finding off targets requires IDs rather than sequence:

./bin/crispr_analyser align -i /lustre/scratch109/sanger/ah19/crispr_indexes/GRCh37_index.bin 245377736 345345636 245373336 

With as many ids as necessary separated by a space.

A range mode is also supported:

./bin/crispr_analyser align -s 245377736 -n 1000

This will output off target data for ids 245377736-245377836

The off target data looks like this:

245377736	1	{2500136,2872353,6251446,...,290706188,293805107,294577530}	{0: 1, 1: 0, 2: 0, 3: 9, 4: 126}

Which is TSV data with 4 columns:

1. CRISPR ID
2. Species ID
3. Postgres array of CRISPR IDs
4. YAML off target summary data string

With the intention being that the output fields are dumped straight into your database

##Server Usage The server supports returns JSON or JSONP if a callback is given.

The server has two modes of operation:

1. Finding off targets given an id (or ids)
2. Retrieving an id given a single 20bp gRNA sequence

###Start the server The server comes with a config file in conf/indexes.conf. You will want to edit this to add whatever species you would like to load. The format is species = index_file, like so:

human = /lustre/scratch110/sanger/team87/crispr_indexes/GRCh37_index.bin

A # can be used at the start of the line for it to be ignored.

The server can be started with just the -c option:

./bin/ots_server -c conf/indexes.conf

Which will start a server with 5 threads on port 8080

The full options:

         -t INT     The number of threads the server should use. Default is 5
         -p INT     The port to run the server on. Default is 8080
         -c FILE    The file containing the species and their index files
                    See conf/indexes.conf for an example
         -d         Daemon mode

If you are at sanger using the default config file should be fine as our indexes are world viewable on lustre.

###Off target searching To find off targets there are two required parameters:

• ids - this can be a single id, or multiple can be specified in a comma separated string, like "253453634,23645743,473539233"
• species - this is a string with whatever species you have added to the server

You can view the json output by simply visiting the appropriate URL:

http://localhost:8080/api/off_targets?ids=245377726&species=human

Or from a javascript console:

$.getJSON("http://localhost:8080/api/off_targets?callback=?", {"ids":"245377736", "species": "Human"}, function (data) { console.log(data) });

Which will return the following wrapped in a callback:

{
    "245377736": {
        "id": 245377736,
        "off_targets": [
            2500136,
            2872353,
            6251446,
            ...
            290706188,
            293805107,
            294577530
        ],
        "off_target_summary": "{0: 1, 1: 0, 2: 0, 3: 9, 4: 126}"
    }
}

#####Multiple IDs: http://localhost:8080/api/off_targets?ids=245377726,245377730&species=human

###Get the sequence for a given ID Thanks to coronin for writing this method. If you don't want to set up a database, you can have the ots server give you the sequence for a given CRISPR using the id api call like so:

$.getJSON('http://localhost:8080/api/id?callback=?', {ids: "245377736", species: "human"}, function (d) { console.log(d); });

Multiple ids can be specified by providing a comma separated string as in the off target example above.

###Sequence searching Sequence searching works in a very similar way:

Viewing the JSON by going straight to the URL:

http://localhost:8080/api/search?seq=TTAATTGTTTAGCAGTGTCA&species=mouse

Or from a javascript console:

$.getJSON("http://localhost:8080/api/search?callback=?", {"seq":"TTAATTGTTTAGCAGTGTCA", "species":"mouse"}, function (data) { console.log(data) });

Which returns:

[342905617]