Skip to content

Commit

Permalink
Designate FW.1.1 (XBB.1.28.1.1.1, S:N148T, UK) with 50 seqs
Browse files Browse the repository at this point in the history
  • Loading branch information
@corneliusroemer
corneliusroemer committed Aug 21, 2023
1 parent 31def30 commit 1c8d6e4
Show file tree
Hide file tree
Showing 2 changed files with 22 additions and 1 deletion.
1 change: 1 addition & 0 deletions lineage_notes.txt
View file
22 changes: 21 additions & 1 deletion lineages.csv
View file

1 comment on commit 1c8d6e4

@FedeGueli
Copy link
Contributor

@FedeGueli FedeGueli commented on 1c8d6e4 Aug 24, 2023 •
edited

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Hi @corneliusroemer i just discovered (maybe i am just the last one to know!) that the vast mayority of XBB.1.28.1 lineage has a Frameshift in the ORF6 leading to the creation of a short 11AA Protein a sort of new "mini" Orf6 . No idea if this could fold properly or have some impact or it could be expressed. Still being XBB.1.28.1 one of the last XBB circualting notwithstanding the fact it has not acquired 486P i think it could interesting to keep this in mind.

Copy&Paste from my comment in the XBB.1.28.1 issue:

" .. I just discovered that the vast mayority (194/240 but further 19 miss it just cause sequencing issue, verified on Nextclade)) of XBB.1.28.1 sequences have a single nucleotide deletion del27208_27208 corresponding to the first nuc of the second codon of Orf6
Schermata 2023-08-24 alle 14 18 28
This consequently causes a frameshift
Schermata 2023-08-24 alle 14 19 44
This frameshift leads to a creation of a short new protein of just 10AA.
Its sequence is radically different from the first 11 AA of the old Orf6:

OLD Orf6:1-11 .= MFHLVDFQVTI (ATGTTTCATCTCGTTGACTTTCAGGTTACTATA)
NEW Orf6:1-11 = MFISLTFRLL* (ATGTTCATCTCGTTGACTTTCAGGTTACTATAG)
Schermata 2023-08-24 alle 14 24 45..."

Please sign in to comment.