version 0.1.0

cran · Mar 16, 2022 · c89aa45 · c89aa45
commit c89aa45
Show file tree

Hide file tree

Showing 42 changed files with 1,666 additions and 0 deletions.
diff --git a/DESCRIPTION b/DESCRIPTION
@@ -0,0 +1,21 @@
+Package: TrustVDJ
+Title: Tools for Immune Repertoire Analysis
+Version: 0.1.0
+Authors@R: 
+    person('Lianhao', 'Song', , 'hatsunecode@gmail.com', role = c('aut', 'cre'),
+           comment = c(ORCID = '0000-0002-3211-3726'))
+Description: A toolkit for read and prepare immune repertoire data. 'TrustVDJ' package focuses on the reading and processing of 'TRUST4' and '10x cellranger' software output results by using 'ReadTrust' and 'Read10x' functions, respectively, and also provides a convenience function 'build_IMGT_reference' to download the 'IMGT' database reference and split its sequences by species.
+BugReports: https://github.com/HatsuneCode/TrustVDJ/issues
+License: GPL (>= 3)
+Encoding: UTF-8
+RoxygenNote: 7.1.2
+Collate: 'constants.r' 'utils.r' 'class.r' 'download.r' 'read10x.r'
+        'readTrust.r' 'refIMGT.r' 'test.r'
+Imports: Biostrings, data.table, methods, rvest, stats
+Suggests: R.utils
+NeedsCompilation: no
+Packaged: 2022-03-16 08:16:27 UTC; lhsong
+Author: Lianhao Song [aut, cre] (<https://orcid.org/0000-0002-3211-3726>)
+Maintainer: Lianhao Song <hatsunecode@gmail.com>
+Repository: CRAN
+Date/Publication: 2022-03-16 21:00:02 UTC
diff --git a/MD5 b/MD5
@@ -0,0 +1,41 @@
+3dcd1af1ade569b81e1690b319f8689f *DESCRIPTION
+330a22f075386d0cea96fdf1d43ff415 *NAMESPACE
+99c5af9bf8918bef2051ce820a841e9b *NEWS.md
+3b26c0338bee9a74dc3fc587f5e5f4d9 *R/class.r
+edd09ab4bbba2a7a1594a2a390899df0 *R/constants.r
+56054decdb3f60cece294fe9fd814f4f *R/download.r
+8ccc63cdf851ef4aa7d94e6029bfae13 *R/read10x.r
+56b5efe3be779c340d1c99e8bd7f21f4 *R/readTrust.r
+fee3c1c86f960c7b8ca7dab5a2605a44 *R/refIMGT.r
+2baa72de3d43675f61d7f2f5b4da79d2 *R/test.r
+6038a55230ccc5b7911a25ff767a8a5d *R/utils.r
+605522a6def929a6708a805568fd0b18 *README.md
+e649fe45c3c94eab9770a9d39f10a4e2 *inst/extdata/10x_airr_rearrangement.tsv.gz
+68d5eedbfaf18969ab935d1860814194 *inst/extdata/10x_all_contig_annotations.csv.gz
+3a8de95b03714801fbb2fd50619f6117 *inst/extdata/10x_clonotypes.csv.gz
+00c1d6e8f285d40f8241875577505824 *inst/extdata/10x_consensus_annotations.csv.gz
+617775d41da98dc2e263597fa339ee32 *inst/extdata/10x_filtered_contig_annotations.csv.gz
+c6cba81dadbf4a54b10dd92f12a83ba8 *inst/extdata/TRUST4_airr.tsv.gz
+03579825a4f909a18102d8f416a79a39 *inst/extdata/TRUST4_barcode_airr.tsv.gz
+08a80d64f7f0f3461394efe43e5258f5 *inst/extdata/TRUST4_barcode_report.tsv.gz
+e3226ad8f9bcbc869768b258a2ec0fdb *inst/extdata/TRUST4_report.tsv.gz
+58260e0dde22ddf36b483b00e019665a *man/Download.Rd
+a37b435443faee6f0592a045080f1628 *man/Ifnone.Rd
+c2c076be4766faa490d4fb14a7246c3d *man/Ifnull.Rd
+287d4fc9becb0013cb6c94ab25059a45 *man/Read10x.Rd
+ff8e7a8d32293646cbe237c4b75604ff *man/ReadTrust.Rd
+45d1b64fa5362e96817beb9a2c609ab8 *man/Trust-class.Rd
+4b14d137fe2ac42a0ae308d8fe77dcf0 *man/build_IMGT_reference.Rd
+e4a8a546e6df44a4a612105ec088436a *man/cbinds.Rd
+856424d513dd4096a532ccb8b06cdfb8 *man/consensus-class.Rd
+8ed573149b71532dc4add472d4f12061 *man/corTest.Rd
+af915e25d696912a8fd4c7203bc14e26 *man/df_chain.Rd
+c354c10cc711fcc10179db46e4b8f7c6 *man/dot-Read10x_clonotype.Rd
+02e7b4d17f542c3faef0d0d0a724cc08 *man/dot-Read10x_consensus.Rd
+fa0f3d7783556d35271fd76421a195da *man/dot-Read10x_contig.Rd
+bb8b049ab6e6343c8070c52a6805d114 *man/dot-ReadAIRR.Rd
+99fba0ea5a868339205cab12751c08d6 *man/dot-ReadTrust_BarcodeReport.Rd
+d29c9a85af4deecd0fb06880d742fbbd *man/dot-ReadTrust_Report.Rd
+4c26bcaee8bcdd5727b46d8ca64d03ba *man/show-Trust-method.Rd
+038dda9ce2bc7f82b9b2d857dc002f6f *man/show-consensus-method.Rd
+8c0089df41287803f4012ca41696c016 *man/timer.Rd
diff --git a/NAMESPACE b/NAMESPACE
@@ -0,0 +1,36 @@
+# Generated by roxygen2: do not edit by hand
+
+export("%||%")
+export("%|||%")
+export(.Read10x_clonotype)
+export(.Read10x_consensus)
+export(.Read10x_contig)
+export(.ReadAIRR)
+export(.ReadTrust_BarcodeReport)
+export(.ReadTrust_Report)
+export(Download)
+export(Read10x)
+export(ReadTrust)
+export(build_IMGT_reference)
+export(cbinds)
+export(corTest)
+export(df_chain)
+export(timer)
+exportClasses(Trust)
+exportClasses(consensus)
+exportMethods(show)
+importFrom(Biostrings,chartr)
+importFrom(Biostrings,readBStringSet)
+importFrom(Biostrings,writeXStringSet)
+importFrom(data.table,fread)
+importFrom(methods,new)
+importFrom(methods,show)
+importFrom(rvest,html_node)
+importFrom(rvest,html_text)
+importFrom(rvest,read_html)
+importFrom(stats,cor.test)
+importFrom(stats,p.adjust)
+importFrom(stats,setNames)
+importFrom(utils,download.file)
+importFrom(utils,setTxtProgressBar)
+importFrom(utils,txtProgressBar)
diff --git a/NEWS.md b/NEWS.md
@@ -0,0 +1,4 @@
+# TrustVDJ 0.1.0
+
+- Initial release of TrustVDJ.
+
diff --git a/R/class.r b/R/class.r
@@ -0,0 +1,102 @@
+#' @include utils.r
+NULL
+
+#' The consensus class
+#'
+#' @slot Vgene   character.     V gene, eg.: TRAV1*01
+#' @slot Dgene   character.     D gene, eg.: TRAD1*01
+#' @slot Jgene   character.     J gene, eg.: TRAJ1*01
+#' @slot Cgene   character.     C gene, eg.: TRAC1*01
+#' @slot CDR1dna character.     CDR1 nucleic acid sequence, eg.: TCTGAACACAACCGC
+#' @slot CDR2dna character.     CDR2 nucleic acid sequence, eg.: TTCCAGAATGAAGCTCAA
+#' @slot CDR3dna character.     CDR3 nucleic acid sequence, eg.: TGTGCCAGCAGCCTACGCAACGAGCAGTACTTC
+#' @slot CDR3aa  character.     CDR3 amino acid sequence, eg.: CASSPTPGEATDTQYF
+#' @slot Count   numeric.       Read counts, eg.: 200
+#' @slot ID      character.     Consensus id, eg.: Sample1_consensus1
+#' @slot CDR3germlineSimilarity numeric. CDR3 germline similarity score, eg.: 80
+#' @slot FullLength logical.    Whether the vdj gene is complete, eg.: TRUE
+#'
+#' @importFrom methods new
+#'
+#' @return An object of the consensus class
+#' @export
+#'
+consensus = setClass('consensus', slots = c(
+  Vgene   = 'character',
+  Dgene   = 'character',
+  Jgene   = 'character',
+  Cgene   = 'character',
+  CDR1dna = 'character',
+  CDR2dna = 'character',
+  CDR3dna = 'character',
+  CDR3aa  = 'character',
+  Count   = 'numeric',
+  ID      = 'character',
+  CDR3germlineSimilarity = 'numeric',
+  FullLength = 'logical'
+))
+
+#' Overview of the consensus class
+#'
+#' @param consensus class. An object of the consensus class
+#' @param object class.
+#'
+#' @importFrom methods show
+#'
+#' @return Brief information about an consensus object
+#' @export
+#'
+setMethod('show', 'consensus', function(object) {
+  cat(length(object@ID), 'consensus contain:\n',
+      sum(!is.na(object@Vgene)),   'Vgene,',
+      sum(!is.na(object@Dgene)),   'Dgene,',
+      sum(!is.na(object@Jgene)),   'Jgene,',
+      sum(!is.na(object@Cgene)),   'Cgene,',
+      sum(!is.na(object@CDR3dna)), 'CDR3_dna and',
+      sum(!is.na(object@CDR3aa)),  'CDR3_aa\n')
+})
+
+#' The Trust class
+#'
+#' The Trust object is the center of each single-cell immune repertoire analysis.
+#' slots are listed below:
+#'
+#' @slot barcode  character. Cell barcode in single-cell sequencing, eg: Sample1_ATGCCAGAACGACT.
+#' @slot celltype character. Inferred cell type, such as: abT, gdT or B.
+#' @slot Achain   consensus. confident TCR/BCR Alpha-chain object.
+#' @slot Bchain   consensus. confident TCR/BCR Beta-chain object.
+#' @slot Achain2  list.      secondary TCR/BCR Alpha-chain objects.
+#' @slot Bchain2  list.      secondary TCR/BCR Beta-chain objects.
+#'
+#' @importFrom methods new
+#'
+#' @return An object of the trust4 class
+#' @export
+#'
+Trust = setClass('Trust', slots = c(
+  barcode  = 'character',
+  celltype = 'character',
+  Achain   = 'consensus',
+  Bchain   = 'consensus',
+  Achain2  = 'list',
+  Bchain2  = 'list'
+))
+
+#' Overview of the Trust class
+#'
+#' @param Trust class. An object of the Trust class
+#' @param object class.
+#'
+#' @importFrom methods show
+#'
+#' @return Brief information about an consensus object
+#' @export
+#'
+setMethod('show', 'Trust', function(object) {
+  cat('Trust object --', length(object@barcode), 'cells contain:\n celltype:',
+      unlist(lapply(unique(object@celltype), function(cell)
+        c(sum(object@celltype %in% cell), cell))) %|||% 'None', '\n')
+  cat(' Alpha-chain(confident):', length(object@Achain@ID), 'consensus \n')
+  cat(' Beta-chain (confident):', length(object@Bchain@ID), 'consensus \n')
+})
+
diff --git a/R/constants.r b/R/constants.r
@@ -0,0 +1,10 @@
+## constants ##
+
+# chain name for TRUST4 barcode report
+chainName = c('v_call', 'd_call', 'j_call', 'c_call',
+              'cdr3', 'cdr3_aa', 'consensus_count', 'sequence_id',
+              'cdr3_germline_similarity', 'complete_vdj')
+
+# consensus name for 10x clonotype report
+consensusName = c('clonotype_id', 'consensus_id', 'clonotype_frequency', 'clonotype_proportion',
+                  'cdr3', 'cdr3_aa', 'clonotype_inkt_evidence', 'clonotypemait_evidence')
diff --git a/R/download.r b/R/download.r
@@ -0,0 +1,74 @@
+#' @include utils.r
+NULL
+
+#' Download files retryable
+#'
+#' @param URLs character/list. URLs to be downloaded.
+#' @param names character/list. file names. Default \code{seq(URLs)}
+#' @param method character. Method to be used for downloading files, equal to \code{download.file}. Default 'libcurl'
+#' @param sleep numeric. retry interval (second). Default 2
+#' @param outdir character. output directory.
+#' @param verbose logical. Default TRUE
+#'
+#' @importFrom utils download.file
+#'
+#' @return if success, return TRUE
+#' @export
+#'
+#' @examples
+#' URLs = paste0('http://www.imgt.org//download/', c('V-QUEST/IMGT_V-QUEST_reference_directory',
+#'          'GENE-DB/IMGTGENEDB-ReferenceSequences.fasta-nt-WithGaps-F+ORF+inframeP'))
+#' \donttest{Download(URLs, c('vdj_species.html', 'IMGT_download.fa'))}
+#'
+Download = function(URLs, names = NULL, method = NULL, sleep = NULL, outdir = NULL, verbose = TRUE){
+
+  # check parameter #
+  URLs   = as.character(unlist(URLs))
+  names  = as.character(unlist(names) %|||% seq(URLs))
+  method = as.character(method %|||% 'libcurl')
+  sleep  = as.numeric(sleep)   %|||% 2
+  outdir = as.character(outdir %|||% getwd())
+
+  # set index
+  log = 'Download.log'
+  writeLines('ok', log)
+
+  for (i in seq(URLs)) {
+    name = names[i]
+    URL  = URLs[i]
+
+    # check file
+    if(!length(list.files(outdir, paste0('^', name, '$')))) {
+
+      # download
+      if(verbose) cat('-->', timer(), i, ': downloading for', name, '<--\n')
+      tryCatch(download.file(URL, paste0(outdir, '/', name), method, TRUE),
+               error = function(e) {
+                 writeLines('Erro', log)
+                 warning('--! ', timer(), ' ', i, ': download fail for ', name, ' !--') })
+
+      # check index
+      Log = readLines(log)
+      if('ok' %in% Log & verbose) cat('-->', timer(), i, ': download ok for', name, '<--\n')
+
+      # retry
+      while ('Erro' %in% Log){
+        writeLines('ok', log)
+        tryCatch(download.file(URL, destfile = paste0(outdir, '/', name), method, TRUE),
+                 error = function(e){
+                   writeLines('Erro', log)
+                   warning('--! ', timer(), ' ', i, ': download fail for ', name, ' !--') })
+
+        # check index
+        Log = readLines(log)
+        if('ok' %in% Log & verbose) cat('-->', timer(), i, ': download ok for', name, '<--\n')
+
+        # sleep
+        Sys.sleep(sleep)
+      }
+    } else warning('--! ', timer(), ' ', i, ': file already exist for ', name, ' !--')
+  }
+
+  # return
+  file.remove(log)
+}