This is the full introductory tutorial for the command line interface (CLI) to ipyrad. Here we will walk through an entire assembly process. The goal is to become familiarized with the general workflow, terminology, data files, and parameter settings in ipyrad. We will use a single-end RAD-seq data set as an example, but the core concepts apply to other data types as well (e.g., GBS and paired-end). Follow along by copy/pasting the code-blocks into a command line terminal.
Note
If you haven't yet installed ipyrad go here first: Installation <installation>
The example data set for this tutorial can be assembled in just a few minutes on a typical laptop computer. Use the commands below to download and extract the data. This will create a new directory called ipsimdata/
located in your current directory.
## The curl command needs a capital O, not a zero
>>> curl -LkO https://github.com/dereneaton/ipyrad/raw/master/tests/ipsimdata.tar.gz
>>> tar -xvzf ipsimdata.tar.gz
Use the command ls
to look inside this directory. You'll see that it contains many different files representing different test data sets.
## the command ls shows you the files inside a directory
>>> ls ipsimdata/
gbs_example_barcodes.txt pairgbs_example_barcodes.txt gbs_example_genome.fa pairgbs_example_R1.fastq.gz gbs_example_R1.fastq.gz pairgbs_example_R2.fastq.gz pairddrad_example_barcodes.txt pairgbs_wmerge_example_barcodes.txt pairddrad_example_R1.fastq.gz pairgbs_wmerge_example_genome.fa pairddrad_example_R2.fastq.gz pairgbs_wmerge_example_R1.fastq.gz pairddrad_wmerge_example_barcodes.txt pairgbs_wmerge_example_R2.fastq.gz pairddrad_wmerge_example_genome.fa rad_example_barcodes.txt pairddrad_wmerge_example_R1.fastq.gz rad_example_genome.fa pairddrad_wmerge_example_R2.fastq.gz rad_example_R1.fastq.gz
For this introductory tutorial we will use just two files from this directory. The file rad_example_R1_.fastq.gz
contains Illumina fastQ formatted reads and is gzip compressed. This is a typical format for raw data. The other file, rad_example_barcodes.txt
, is a tab-separated table matching barcodes to sample IDs.
Note
If you have multiple plates of data or if your data was already demultiplexed when you received it, we still recommend you complete the intro tutorial with the simulated data, but then see (tutorial combining data <tutorial_combining_data>
) for specific instructions on how to read in previously demultiplexed samples and how to merge multiple plates of data.
Before we get started let's take a look at what the raw data looks like. Your input data will be in fastQ format, usually ending in .fq
, .fastq
, .fq.gz
, or .fastq.gz
. It can be split among multiple files, or all within a single file. In this tutorial the data are not yet demultiplexed (sorted into separate files for each sample), and so we will start by demultiplexing the data files. For this, we enter the location of our fastQ data files on line 2 of the params file ('raw_fastq_path'). If the data were already demultiplexed we would instead enter the location of the data files on line 4 of the params file ("sorted_fastq_path"). Below are the first three reads in the example file.
## For your personal edification here is what this is doing:
## gzip -c: Tells gzip to unzip the file and write the contents to the screen
## head -n 12: Grabs the first 12 lines of the fastq file.
>>> gunzip -c ./ipsimdata/rad_example_R1_.fastq.gz | head -n 12
And here's the output:
@lane1_locus0_2G_0_R1_0 1:N:0: GAGGAGTGCAGCCCCTATGTGTCCGGCACCCCAACGCCTTGGAACTCAGTTAACTGTTCAAGTTGGGCAAGATCAAGTCGTCCCCTTAGCCCCCGCTCCG + BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB @lane1_locus0_2G_0_R1_1 1:N:0: GAGGAGTGCAGCCCCTATGTGTCCGGCACCCCAACGCCTTGGAACTCAGTTAACTGTTCAAGTTGGGCAAGATCAAGTCGTCCCCTTAGCCCCCGCTCCG + BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB @lane1_locus0_2G_0_R1_2 1:N:0: GAGGAGTGCAGCCCCTATGTGTCCGGCACCCCAACGCCTTGGAACTCAGTTAACTGTTCAAGTTGGGCAAGATCAAGTCGTCCCCTTAGCCCCCGCTCCG + BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
Each read takes four lines. The first is the name of the read (its location on the plate). The second line contains the sequence data. The third line is a spacer. And the fourth line the quality scores for the base calls. In this case arbitrarily high since the data were simulated.
These are 100 bp single-end reads prepared as RAD-seq. The first six bases form the barcode (TTTTAA) and the next five bases (TGCAG) the restriction site overhang. All following bases make up the sequence data.
Lets also take a look at the barcodes file for the simulated data. You'll see sample names (left) and their barcodes (right) each on a separate line with a tab between them.
>>> cat ./ipsimdata/rad_example_barcodes.txt
1A_0 CATCAT 1B_0 AGTGAT 1C_0 ATGGTA 1D_0 GTAGGA 2E_0 AAAGTG 2F_0 GATATA 2G_0 GAGGAG 2H_0 GGGATT 3I_0 TAATTA 3J_0 TGAGGG 3K_0 TGTAGT 3L_0 GTGTGT
ipyrad uses a simple text file to hold all the parameters for a given assembly. Start by creating a new params file using the -n
flag, followed by a name for your assembly. In the example we use the name iptest
, but the name can be anything at all. Once you start analysing your own data you might call your params file something more informative, like the name of your organism. We will refer to this as the "assembly_name".
>>> ipyrad -n iptest
New file params-iptest.txt created in /home/deren/Documents/ipyrad/tests
This will create a file in the current directory called params-iptest.txt
. The params file lists on each line one parameter followed by a ## mark, then the name of the parameter, and then a short description of its purpose. Take a look at it by using the unix command 'cat' (or you can use any text editor you like).
>>> cat params-iptest.txt
------- ipyrad params file (v.0.5.15)-------------------------------------------iptest ## [0] [assembly_name]: Assembly name. Used to name output directories for assembly steps ./ ## [1] [project_dir]: Project dir (made in curdir if not present) ## [2] [raw_fastq_path]: Location of raw non-demultiplexed fastq files ## [3] [barcodes_path]: Location of barcodes file ## [4] [sorted_fastq_path]: Location of demultiplexed/sorted fastq files denovo ## [5] [assembly_method]: Assembly method (denovo, reference, denovo+reference, denovo-reference) ## [6] [reference_sequence]: Location of reference sequence file rad ## [7] [datatype]: Datatype (see docs): rad, gbs, ddrad, etc. TGCAG, ## [8] [restriction_overhang]: Restriction overhang (cut1,) or (cut1, cut2) 5 ## [9] [max_low_qual_bases]: Max low quality base calls (Q<20) in a read 33 ## [10] [phred_Qscore_offset]: phred Q score offset (33 is default and very standard) 6 ## [11] [mindepth_statistical]: Min depth for statistical base calling 6 ## [12] [mindepth_majrule]: Min depth for majority-rule base calling 10000 ## [13] [maxdepth]: Max cluster depth within samples 0.85 ## [14] [clust_threshold]: Clustering threshold for de novo assembly 0 ## [15] [max_barcode_mismatch]: Max number of allowable mismatches in barcodes 0 ## [16] [filter_adapters]: Filter for adapters/primers (1 or 2=stricter) 35 ## [17] [filter_min_trim_len]: Min length of reads after adapter trim 2 ## [18] [max_alleles_consens]: Max alleles per site in consensus sequences 5, 5 ## [19] [max_Ns_consens]: Max N's (uncalled bases) in consensus (R1, R2) 8, 8 ## [20] [max_Hs_consens]: Max Hs (heterozygotes) in consensus (R1, R2) 4 ## [21] [min_samples_locus]: Min # samples per locus for output 20, 20 ## [22] [max_SNPs_locus]: Max # SNPs per locus (R1, R2) 8, 8 ## [23] [max_Indels_locus]: Max # of indels per locus (R1, R2) 0.5 ## [24] [max_shared_Hs_locus]: Max # heterozygous sites per locus (R1, R2) 0, 0 ## [25] [trim_reads]: Trim raw read edges (5'>, <3') applies same to pairs (see docs) 0, 0, 0, 0 ## [26] [trim_loci]: Trim locus edges (see docs) (R1>, <R1, R2>, <R2) p, s, v ## [27] [output_formats]: Output formats (see docs) ## [28] [pop_assign_file]: Path to population assignment file
In general the default parameter values are sensible, and we won't mess with them for now, but there are a few parameters we must change. We need to set the path to the raw data we want to analyse, and we need to set the path to the barcodes file.
In your favorite text editor (nano is a popular command line editor for linux, for Mac you can use TextEdit) open params-iptest.txt
and change these two lines to look like this, and then save it. If you use a GUI editor be sure the file saves as plain '.txt', no fancy business (e.g. .docx or .rtf). Also, be careful of typos, if you enter the paths incorrectly ipyrad will raise an error and tell you that it can't find your data files:
./ipsimdata/rad_example_R1.fastq.gz ## [2] [raw_fastq_path]: Location of raw non-demultiplexed fastq files ./ipsimdata/rad_example_barcodes.txt ## [3] [barcodes_path]: Location of barcodes file
Now we will start assembling the data with ipyrad. Step 1 reads in the barcodes file and the raw data. It scans through the raw data and sorts each read based on the mapping of samples to barcodes. At the end of this step we'll have a new directory in our project_dir called iptest_fastqs/
. Inside this directory will be individual fastq.gz files for each sample.
Note
tldr; Please do not move or rename directories that ipyrad creates or your assembly will break.
You'll notice the name of this output directory bears a strong resemblence to the name of the assembly we chose at the time of the params file creation. Assembling rad-seq type sequence data requires a lot of different steps, and these steps generate a lot of intermediary files. ipyrad organizes these files into directories, and it prepends the name of your assembly to each directory with data that belongs to it. One result of this is that you can have multiple assemblies of the same raw data with different parameter settings and you don't have to manage all the files yourself! (See Branching assemblies <tutorial_advanced_CLI>
for more info). Another result is that you should not rename or move any of the directories inside your project directory, unless you know what you're doing or you don't mind if your assembly breaks.
Now lets run step 1! For the simulated data this will take just a few seconds.
## -p indicates the params file we wish to use
## -s indicates the step to run (in this case 1)
>>> ipyrad -p params-iptest.txt -s 1
-------------------------------------------------------------ipyrad [v.0.5.15] Interactive assembly and analysis of RAD-seq data -------------------------------------------------------------loading Assembly: iptest from saved path: ~/Documents/ipyrad/tests/iptest.json New Assembly: iptest host compute node: [8 cores] on tinus
Step 1: Demultiplexing fastq data to Samples
[####################] 100% sorting reads | 0:00:04 [####################] 100% writing/compressing | 0:00:00
There are 4 main parts to this step: (1) It creates a new Assembly called iptest, since this is our first time running any steps for the named assembly; (2) It launches a number of parallel Engines, by default this is the number of available CPUs on your machine; (3) It performs the step functions, in this case it sorts the data and writes the outputs; and (4) It saves the Assembly.
Have a look at the results of this step in the iptest_fastqs/
output directory:
>>> ls iptest_fastqs
1A_0_R1.fastq.gz 1D_0_R1.fastq.gz 2G_0_R1.fastq.gz 3J_0_R1.fastq.gz s1_demultiplex_stats.txt 1B_0_R1.fastq.gz 2E_0_R1.fastq.gz 2H_0_R1.fastq.gz 3K_0_R1.fastq.gz 1C_0_R1.fastq.gz 2F_0_R1.fastq.gz 3I_0_R1.fastq.gz 3L_0_R1.fastq.gz
A more informative metric of success might be the number of raw reads demultiplexed for each sample. Fortunately ipyrad tracks the state of all your steps in your current assembly, so at any time you can ask for results by invoking the -r
flag.
## -r fetches informative results from currently executed steps
>>> ipyrad -p params-iptest.txt -r
Summary stats of Assembly iptest ------------------------------------------------state reads_raw 1A_0 1 19862 1B_0 1 20043 1C_0 1 20136 1D_0 1 19966 2E_0 1 20017 2F_0 1 19933 2G_0 1 20030 2H_0 1 20199 3I_0 1 19885 3J_0 1 19822 3K_0 1 19965 3L_0 1 20008
step 1: ./iptest_fastqs/s1_demultiplex_stats.txt step 2: None step 3: None step 4: None step 5: None step 6: None step 7: None
If you want to get even more info ipyrad tracks all kinds of wacky stats and saves them to a file inside the directories it creates for each step. For instance to see full stats for step 1:
>>> cat ./iptest_fastqs/s1_demultiplex_stats.txt
And you'll see a ton of fun stuff I won't copy here in the interest of conserving space (you'll see more still on real empirical data versus the simulated data here). Please go look for yourself if you're interested.
This step filters reads based on quality scores, and can be used to detect Illumina adapters in your reads, which is a common concern with any NGS data set, and especially so for homebrew type library preparations. Here the filter is set to the default value of 0 (zero), meaning it filters only based on quality scores of base calls, and does not search for adapters. This is a good option if your data are already pre-filtered. The resuling filtered files from step 2 are written to a new directory called iptest_edits/
.
>>> ipyrad -p params-iptest.txt -s 2
-------------------------------------------------------------ipyrad [v.0.5.15] Interactive assembly and analysis of RAD-seq data -------------------------------------------------------------loading Assembly: iptest from saved path: ~/Documents/ipyrad/tests/iptest.json host compute node: [8 cores] on tinus
Step 2: Filtering reads [####################] 100% processing reads | 0:00:02
Again, you can look at the results output by this step and also some handy stats tracked for this assembly.
## View the output of step 2
>>> ls iptest_edits/
1A_0_R1.fastq 1C_0_R1.fastq 2E_0_R1.fastq 2G_0_R1.fastq 3I_0_R1.fastq 3K_0_R1.fastq s2_rawedit_stats.txt 1B_0_R1.fastq 1D_0_R1.fastq 2F_0_R1.fastq 2H_0_R1.fastq 3J_0_R1.fastq 3L_0_R1.fastq
## Get current stats including # raw reads and # reads
## after filtering.
>>> ipyrad -p params-iptest.txt -r
Summary stats of Assembly iptest ------------------------------------------------state reads_raw reads_passed_filter 1A_0 2 19862 19862 1B_0 2 20043 20043 1C_0 2 20136 20136 1D_0 2 19966 19966 2E_0 2 20017 20017 2F_0 2 19933 19933 2G_0 2 20030 20030 2H_0 2 20199 20199 3I_0 2 19885 19885 3J_0 2 19822 19822 3K_0 2 19965 19965 3L_0 2 20008 20008
step 1: ./iptest_fastqs/s1_demultiplex_stats.txt step 2: ./iptest_edits/s2_rawedit_stats.txt step 3: None step 4: None step 5: None step 6: None step 7: None
You might also take a gander at the filtered reads:
>>> head -n 12 ./iptest_edits/1A_0_R1.fastq
Note
A note on performance expectations. Steps 3 and 6 are the "clustering" steps. These are by far the most intensive steps and on real data you should expect them to take quite a bit longer than the other steps. Here on the toy data it will take a few minutes. See the performance expectations <performance>
docs for more specifics.
Step 3 de-replicates and then clusters reads within each sample by the set clustering threshold and then writes the clusters to new files in a directory called iptest_clust_0.85/
. Intuitively we are trying to identify all the reads that map to the same locus within each sample. The clustering threshold specifies the minimum percentage of sequence similarity below which we will consider two reads to have come from different loci.
The true name of this output directory will be dictated by the value you set for the clust_threshold
parameter in the params file.
0.85 ## [14] [clust_threshold]: proportion identical for clustering
You can see the default value is 0.85, so our default directory is named accordingly. This value dictates the percentage of sequence similarity that reads must have in order to be considered reads at the same locus. You may want to experiment with this value, but 0.85-0.90 is a fairly reliable range, balancing over-splitting of loci vs over-lumping. Don't mess with this until you feel comfortable with the overall workflow, and also until you've learned about Branching assemblies <branching_workflow>
.
Later you will learn how to incorporate information from a reference genome (if you have one) to improve clustering at this step. For now, bide your time (but see Reference sequence mapping <tutorial_advanced_cli>
if you're impatient).
Now lets run step 3:
>>> ipyrad -p params-iptest.txt -s 3
-------------------------------------------------------------ipyrad [v.0.5.15] Interactive assembly and analysis of RAD-seq data -------------------------------------------------------------loading Assembly: iptest from saved path: ~/Documents/ipyrad/tests/iptest.json host compute node: [8 cores] on tinus
Step 3: Clustering/Mapping reads [####################] 100% dereplicating | 0:00:00 [####################] 100% clustering | 0:00:00 [####################] 100% building clusters | 0:00:00 [####################] 100% chunking | 0:00:00 [####################] 100% aligning | 0:00:03 [####################] 100% concatenating | 0:00:00
Again we can examine the results. The stats output tells you how many clusters were found, and the number of clusters that pass the mindepth thresholds. We'll go into more detail about mindepth settings in some of the advanced tutorials but the important thing to know is that by default step 3 will filter out clusters that only have a handful of reads since we have little power to make confident base calls in low depth clusters.
>>> ipyrad -p params-iptest.txt -r
Summary stats of Assembly iptest ------------------------------------------------state reads_raw reads_passed_filter clusters_total clusters_hidepth 1A_0 3 19862 19862 1000 1000 1B_0 3 20043 20043 1000 1000 1C_0 3 20136 20136 1000 1000 1D_0 3 19966 19966 1000 1000 2E_0 3 20017 20017 1000 1000 2F_0 3 19933 19933 1000 1000 2G_0 3 20030 20030 1000 1000 2H_0 3 20199 20199 1000 1000 3I_0 3 19885 19885 1000 1000 3J_0 3 19822 19822 1000 1000 3K_0 3 19965 19965 1000 1000 3L_0 3 20008 20008 1000 1000
step 1: ./iptest_fastqs/s1_demultiplex_stats.txt step 2: ./iptest_edits/s2_rawedit_stats.txt step 3: ./iptest_clust_0.85/s3_cluster_stats.txt step 4: None step 5: None step 6: None step 7: None
The aligned clusters found during this step are now located in ./iptest_clust_0.85/
. You can get a feel for what this looks like by examining a portion of one of the files using the command below.
## Same as above, gunzip -c means print to the screen and
## `head -n 28` means just show me the first 28 lines. If
## you're interested in what more of the loci look like
## you can increase the number of lines you ask head for,
## e.g. ... | head -n 100
>>> gunzip -c iptest_clust_0.85/1A_0.clustS.gz | head -n 28
Reads that are sufficiently similar (based on the above sequence similarity threshold) are grouped together in clusters separated by "//". For the first cluster below there is clearly one allele (homozygote) and one read with a (simulated) sequencing error. This is apparent in the 'size=' field of the two reads for this cluster. For the second cluster it seems there are two alleles (heterozygote), and a read with a sequencing error. For the third cluster it's a bit harder to say. Is this a homozygote with lots of sequencing errors, or a heterozygote with few reads for one of the alleles? Thankfully, untangling this mess is what steps 4 and 5 are all about.
>1A_0_1164_r1;size=16;*0 TGCAGCTATTGCGACAAAAACACGACGGCTTCCGTGGGCACTAGCGTAATTCGCTGAGCCGGCGTAACAGAAGGAGTGCACTGCCACGTGCCCG >1A_0_1174_r1;size=1;+1 TGCAGCTATTGCGACAAAAACACGACGGCTTCCGTGGGCACTAGCGTAATTCGCTGAGCCGGCGTAACAGAAGGAGTGCACTGCCACATGCCCG // // >1A_0_4137_r1;size=10;*0 TGCAGGGTCGCCGGCAACTCAGCATTTTAACTCCGCGGGTTACACGTGCGGAGGCCTACTGGCTATCATTTTTAGGGTGCATTTGGTCGGCTGG >1A_0_4130_r1;size=6;+1 TGCAGGGTCGCCGGCAACTCAGCATTTTAACTCCGCGGGTTACACGTGTGGAGGCCTACTGGCTATCATTTTTAGGGTGCATTTGGTCGGCTGG >1A_0_4131_r1;size=1;+2 TGCAGGGTCGCCGGCAACTCAGCATTTTAACTCCGCGGGTTACACGTGTCGAGGCCTACTGGCTATCATTTTTAGGGTGCATTTGGTCGGCTGG // // >1A_0_6246_r1;size=15;*0 TGCAGATACAAAAGCTTGCCCACTAAGTTGTGTGATCACTGTCTTATTACGGTGGCCTCCTTCAAGCTTCGAACGAGTTGTGGATCGGTAGGCT >1A_0_6259_r1;size=1;+1 TGCAGATACAAAAGCTTGCCCACTAAGTTGTGTGATCACTGTCTTATTACGGTGGCCTCCTTCAAGCTTCGAACGAGTTGTGGATCGGGAGGCT >1A_0_6264_r1;size=1;+2 TGCAGATACAAAAGCTTGCCCACTAAGTTGTGTGATCACTGTCTTATTACGGTGGCCTCCTACAAGCTTCGAACGAGTTGTGGATCGGTAGGCT >1A_0_6268_r1;size=1;+3 TGCAGATTCAAAAGCTTGCCCACTAAGTTGTGTGATCACTGTCTTATTACGGTGGCCTCCTTCAAGCTTCGAACGAGTTGTGGATCGGTAGGCT // //
Step 4 jointly estimates sequencing error rate and heterozygosity to disentangle which reads are "real" and which are sequencing error. We need to know which reads are "real" because in diploid organisms there are a maximum of 2 alleles at any given locus. If we look at the raw data and there are 5 or ten different "alleles", and 2 of them are very high frequency, and the rest are singletons then this gives us evidence that the 2 high frequency alleles are good reads and the rest are probably not. This step is pretty straightforward, and pretty fast. Run it thusly:
>>> ipyrad -p params-iptest.txt -s 4
-------------------------------------------------------------ipyrad [v.0.5.15] Interactive assembly and analysis of RAD-seq data -------------------------------------------------------------loading Assembly: iptest from saved path: ~/Documents/ipyrad/tests/iptest.json host compute node: [8 cores] on tinus
Step 4: Joint estimation of error rate and heterozygosity [####################] 100% inferring [H, E] | 0:00:02
This step does not produce new output files, only a stats file with the estimated heterozygosity and error rate parameters. You can also invoke the -r
flag to see the estimated values.
>>> ipyrad -p params-iptest.txt -r
Summary stats of Assembly iptest ------------------------------------------------state reads_raw reads_passed_filter clusters_total clusters_hidepth 1A_0 4 19862 19862 1000 1000 1B_0 4 20043 20043 1000 1000 1C_0 4 20136 20136 1000 1000 1D_0 4 19966 19966 1000 1000 2E_0 4 20017 20017 1000 1000 2F_0 4 19933 19933 1000 1000 2G_0 4 20030 20030 1000 1000 2H_0 4 20199 20199 1000 1000 3I_0 4 19885 19885 1000 1000 3J_0 4 19822 19822 1000 1000 3K_0 4 19965 19965 1000 1000 3L_0 4 20008 20008 1000 1000
hetero_est error_est
1A_0 0.001824 0.000759 1B_0 0.001908 0.000752 1C_0 0.002084 0.000745 1D_0 0.001803 0.000761 2E_0 0.001830 0.000766 2F_0 0.001996 0.000755 2G_0 0.001940 0.000763 2H_0 0.001747 0.000756 3I_0 0.001807 0.000758 3J_0 0.001931 0.000776 3K_0 0.002092 0.000766 3L_0 0.002042 0.000748
step 1: ./iptest_fastqs/s1_demultiplex_stats.txt step 2: ./iptest_edits/s2_rawedit_stats.txt step 3: ./iptest_clust_0.85/s3_cluster_stats.txt step 4: ./iptest_clust_0.85/s4_joint_estimate.txt step 5: None step 6: None step 7: None
Step 5 uses the inferred error rate and heterozygosity to call the consensus of sequences within each cluster. Here we are identifying what we believe to be the real haplotypes at each locus within each sample.
>>> ipyrad -p params-iptest.txt -s 5
-------------------------------------------------------------ipyrad [v.0.5.15] Interactive assembly and analysis of RAD-seq data -------------------------------------------------------------loading Assembly: iptest from saved path: ~/Documents/ipyrad/tests/iptest.json host compute node: [8 cores] on tinus
Step 5: Consensus base calling Mean error [0.00076 sd=0.00001] Mean hetero [0.00192 sd=0.00012] [####################] 100% calculating depths | 0:00:01 [####################] 100% chunking clusters | 0:00:00 [####################] 100% consens calling | 0:00:10
Again we can ask for the results:
>>> ipyrad -p params-iptest.txt -r
And here the important information is the number of reads_consens
. This is the number of "good" reads within each sample that we'll send on to the next step. As you'll see in examples with empirical data, this is often a step where many reads are filtered out of the data set. If no reads were filtered, then the number of reads_consens should be equal to the number of clusters_hidepth.
Summary stats of Assembly iptest ------------------------------------------------state reads_raw reads_passed_filter clusters_total clusters_hidepth 1A_0 5 19862 19862 1000 1000 1B_0 5 20043 20043 1000 1000 1C_0 5 20136 20136 1000 1000 1D_0 5 19966 19966 1000 1000 2E_0 5 20017 20017 1000 1000 2F_0 5 19933 19933 1000 1000 2G_0 5 20030 20030 1000 1000 2H_0 5 20199 20199 1000 1000 3I_0 5 19885 19885 1000 1000 3J_0 5 19822 19822 1000 1000 3K_0 5 19965 19965 1000 1000 3L_0 5 20008 20008 1000 1000
hetero_est error_est reads_consens
1A_0 0.001824 0.000759 1000 1B_0 0.001908 0.000752 1000 1C_0 0.002084 0.000745 1000 1D_0 0.001803 0.000761 1000 2E_0 0.001830 0.000766 1000 2F_0 0.001996 0.000755 1000 2G_0 0.001940 0.000763 1000 2H_0 0.001747 0.000756 1000 3I_0 0.001807 0.000758 1000 3J_0 0.001931 0.000776 1000 3K_0 0.002092 0.000766 1000 3L_0 0.002042 0.000748 1000
step 1: ./iptest_fastqs/s1_demultiplex_stats.txt step 2: ./iptest_edits/s2_rawedit_stats.txt step 3: ./iptest_clust_0.85/s3_cluster_stats.txt step 4: ./iptest_clust_0.85/s4_joint_estimate.txt step 5: ./iptest_consens/s5_consens_stats.txt step 6: None step 7: None
This step creates a new directory called ./iptest_consens
to store the consensus sequences for each sample. We can use our trusty head
command to look at the output.
>>> gunzip -c iptest_consens/1A_0.consens.gz | head
You can see that all loci within each sample have been reduced to one consensus sequence. Heterozygous sites are represented by IUPAC ambiguity codes (find the K in sequence 1A_0_1
), and all other sites are homozygous.
>1A_0_0 TGCAGTATTGGCTGCCCCATCTTACGCTTGGTAATTTTCGCCTTTTCAACTGCATCCGCTAAATCTGCCATCTTTAAGCGTAGTCACTTCCACA >1A_0_1 TGCAGCGKTACGCTCCTAGGGAACGTCCACGTCTCGGCAGTCGTCAGGTACTTTTAGCCTCTTGCCGCGCATCTCATGGGAGCAACGTGAGCCT >1A_0_2 TGCAGACGGGAAACTTTAAAAAATAAAGCAATTGCTGCCATCTATGGGCGGTTTGAATGGGTTTTTTAGTGCCTCTACTATTAATTATGTGATC >1A_0_3 TGCAGAGAGTGAACATCAGAAGACAGGTGGGTAGAAGACGCAACTTAGGACCTAAGGTTCTGGAGCTATTTTAAGTTCGACAGACAGGTCCAGC >1A_0_4 TGCAGCGTGCTAAGGTTTGAGACATATAGCGAAGAACCTACGACGGTCGAATCTGACGGCGCTAAGCTGTGTGGACCTTAGTATTAGGCGGAAA
Step 6 clusters consensus sequences across samples. Now that we have good estimates for haplotypes within samples we can try to identify similar sequences at each locus between samples. We use the same clustering threshold as step 3 to identify sequences between samples that are probably sampled from the same locus, based on sequence similarity.
>>> ipyrad -p params-iptest.txt -s 6
-------------------------------------------------------------ipyrad [v.0.5.15] Interactive assembly and analysis of RAD-seq data -------------------------------------------------------------loading Assembly: iptest from saved path: ~/Documents/ipyrad/tests/iptest.json host compute node: [8 cores] on tinus
Step 6: Clustering at 0.85 similarity across 12 samples [####################] 100% concat/shuffle input | 0:00:00 [####################] 100% clustering across | 0:00:00 [####################] 100% building clusters | 0:00:01 [####################] 100% aligning clusters | 0:00:03 [####################] 100% database indels | 0:00:00 [####################] 100% indexing clusters | 0:00:01 [####################] 100% building database | 0:00:00
This step differs from previous steps in that we are no longer applying a function to each Sample individually, but instead we apply it to all Samples collectively. Our end result is a map telling us which loci cluster together from which Samples. This output is stored as an HDF5 database (iptest_test.hdf5
), which is not easily human readable. It contains the clustered sequence data, depth information, phased alleles, and other metadata. If you really want to see the contents of the database see the h5py cookbook recipe.
There is no simple way to summarize the outcome of step 6, so the output of ipyrad -p params-iptest -r
and the content of the ./iptest_consens/s6_cluster_stats.txt
stats file are uniquely uninteresting.
The final step is to filter the data and write output files in many convenient file formats. First we apply filters for maximum number of indels per locus, max heterozygosity per locus, max number of snps per locus, and minimum number of samples per locus. All these filters are configurable in the params file and you are encouraged to explore different settings, but the defaults are quite good and quite conservative.
After running step 7 like so:
>>> ipyrad -p params-iptest.txt -s 7
-------------------------------------------------------------ipyrad [v.0.5.15] Interactive assembly and analysis of RAD-seq data -------------------------------------------------------------loading Assembly: iptest from saved path: ~/Documents/ipyrad/tests/iptest.json host compute node: [8 cores] on tinus
Step 7: Filter and write output files for 12 Samples [####################] 100% filtering loci | 0:00:05 [####################] 100% building loci/stats | 0:00:00 [####################] 100% building vcf file | 0:00:01 [####################] 100% writing vcf file | 0:00:00 [####################] 100% building arrays | 0:00:01 [####################] 100% writing outfiles | 0:00:02 Outfiles written to: ~/Documents/ipyrad/tests/iptest_outfiles
A new directory is created called iptest_outfiles
. This directory contains all the output files specified in the params file. The default is to create all supported output files which include PHYLIP(.phy), NEXUS(.nex), EIGENSTRAT's genotype format(.geno), STRUCTURE(.str), as well as many others. Explore some of these files below.
The final stats output file contains a large number of statistics telling you why some loci were filtered from the data set, how many loci were recovered per sample, how many loci were shared among some number of samples, and how much variation is present in the data. Check out the results file.
## The number of loci caught by each filter. ## ipyrad API location: [assembly].statsfiles.s7_filters
total_filters applied_order retained_loci
total_prefiltered_loci 1000 0 1000 filtered_by_rm_duplicates 0 0 1000 filtered_by_max_indels 0 0 1000 filtered_by_max_snps 0 0 1000 filtered_by_max_shared_het 0 0 1000 filtered_by_min_sample 0 0 1000 filtered_by_max_alleles 0 0 1000 total_filtered_loci 1000 0 1000
## The number of loci recovered for each Sample. ## ipyrad API location: [assembly].stats_dfs.s7_samples
sample_coverage
1A_0 1000 1B_0 1000 1C_0 1000 1D_0 1000 2E_0 1000 2F_0 1000 2G_0 1000 2H_0 1000 3I_0 1000 3J_0 1000 3K_0 1000 3L_0 1000
## The number of loci for which N taxa have data. ## ipyrad API location: [assembly].stats_dfs.s7_loci
locus_coverage sum_coverage
1 0 0 2 0 0 3 0 0 4 0 0 5 0 0 6 0 0 7 0 0 8 0 0 9 0 0 10 0 0 11 0 0 12 1000 1000
## The distribution of SNPs (var and pis) across loci. ## var = all variable sites (pis + autapomorphies) ## pis = parsimony informative site (minor allele in >1 sample) ## ipyrad API location: [assembly].stats_dfs.s7_snps
var sum_var pis sum_pis
0 16 0 331 0 1 55 55 376 376 2 106 267 208 792 3 208 891 52 948 4 198 1683 26 1052 5 145 2408 4 1072 6 124 3152 3 1090 7 69 3635 0 1090 8 50 4035 0 1090 9 12 4143 0 1090 10 10 4243 0 1090 11 3 4276 0 1090 12 3 4312 0 1090 13 1 4325 0 1090
Check out the .loci
output (this is ipyrad native internal format). Each locus is delineated by a pair of forward slashes //
. Within each locus are all the reads from each sample that clustered together. The line containing the //
also indicates the positions of SNPs in the sequence. See if you can spot the SNPs in the first locus. Many more output formats are available. See the section on output formats<full_output_formats>
for more information.
>>> less iptest_outfiles/iptest.loci
1A_0 GGTGGGCAGTAGTCTCGCGGATGATCTAGAAACTTCATACGTTGTATAAGTGGAACGGAGGATACCCTGGGCATCCCCGGTAGACATC 1B_0 GGTGGGCAGTAGTCTCGCGGATGATCTAGAAACTTCATACGTTGTATAAGTGGAACGGAGGATACCCTGGGCATCCCCGGTAGACATC 1C_0 GGTGGGCAGTAGTCTCGCGGATGATCTAGAAACTTCATACGTTGTATAAGTGGAACGGAGGATACCCTGGGCATACCCGGTAGACATC 1D_0 GGTGGGCAGTAGTCTCKCGGATGATCTAGAAACTTCATACGTTGTATAAGTGKAACGGAGGATACCCTGGGCATCCCCGGTAGACATC 2E_0 GGTGGGCAGTAGTCTCGCGGATGATCTAGAAACTTCATACGTTGTATAAGTGGAACGGAGGATACCCTGGGCATCCCCGGTAGACATC 2F_0 GGTGGGCAGTAGTCTCGCGGATGATCTAGAAACTTCATACGTTGTATAAGTGGAACGGAGGATACCCTGGGCATCCCCGGTAGACATC 2G_0 GGTGGGCAGTAGTCTCGCGGATGATCTAGAAACTTCATACGTTGTATAAGTGGAACGGAGGATACCCTGGGCATCCCCGGTAGACATC 2H_0 GGTGGGCAGTAGTCTCGCGGATGATCTAGAAACTTCATACGTTCTATAAGTGGAACGGAGGATACCCTGGGCATCCCCGGTAGACATC 3I_0 GGTGGGCAGTAGTCTCGCGGATGATCTAGAAACTTCATACGTTGTATAAGTGGAACGGRGGATACCCTGGGCATCCCCGGTAGACATC 3J_0 GGTGGGCAGTAGTCTCGCGGATGATCTAGAAACTTCATACGTTGTATAAGTGGAACGGAGGATACCCTGGGCATCCCCGGTAGACATC 3K_0 GGTGGGCAGTAGTCTCGCGGATGATCTAGAAACTTCATACGTTGTATAAGTGGAACGGAGRATACCCTGGGCATCCCCGGTAGACATC 3L_0 GGTGGGCAGTAGTCTCGCGGATGATCTAGAAACTTCATACGTTGTATAAGTGGAACGGAGGATACCCTGGGCATCCCCGGTAGACATC // - - - - - - 1A_0 CAATTTAAACATGGCCTGTTTTGGGCCTCTTAAACAGCCATCACTACGCTGCGGAGCCACGGAGACTGCAAGTCACAATAAGAGTCGA 1B_0 CAATTTAAACATGGCCTGTTTTGGGCC-CTTAAACAGCCATCA-TACGCTGCGGAGCCACGGAGACTGCAAGTCACAATAAGAGT-GA 1C_0 CAATTTAAACATGGCCTGTTTTGGGCCTCTTAAACAGCCATCACTACGCTGCGGAGCCACGGAGACTGCAAGTCAAAATAAGAGTCGA 1D_0 CAATTTAAACATGGCCTGTTTTGGGCCTCTTAACCAGCCATCACTACGCTGCGGAGCCACGGAGACTGCAAGTCACAATAAGAGTCGA 2E_0 CAATTTAAACATGGCCTGTTTTGGGCCTCTTAAACAGCCATCACTACGGTGCGGAGCCACGGAGACTGCAAGTCACAATAAGACTCGA 2F_0 CAATTTAAACATGGCCTGTTTTGGGCCTCTTAAACAGCCATCACTACGCTGCGGARCCACGGAGACTGCAAGTCACAATAAGACTCGA 2G_0 CAATTTAAACATGGCCTGTTTTGGGCCTCTTAAACAGCCATCACTACGCTGCGGAGCCACGGAGACTGCAAGTCACAATAAGAGTCGA 2H_0 CAATTTAAACATGGCCTGTTTTGGGCCTCTTAAACAGCCATCACTACGCTGCGGAGCCACGGAGACTGCAAGTCACAATAAGAGTCGA 3I_0 CAATTTAAACATGGCCTGTTTTGGGCCTCTTAAACAGCCATCACTACGCTGCGGAGCCACGGAGACTGCAAGTCACAATAAGAGTCGA 3J_0 CAATTTAAACATGGCCTGTTTTGGGCCTCTTAAACAGCCATCACTACGCTGCGGAGCCACGGAGACTGCAAGTCACAATAAGAGTCGA 3K_0 CAATTTAAACATGGCCTGTTTTGGGCCTCTTAAACAGCCATCACTACGCTGCGGAGCCACGGAGACTGCAAGTCACAATAAGAGTCGA 3L_0 CAATTTAAACATGGCCTGTTTTGGGCCTCTTAAACAGCCATCACTACGCTGCGGAGCCACGGAGACTGCAAGTCACAATAAGAGTCGA // - - - - *
Congratulations! You've completed your first toy assembly. Now you can try applying what you've learned to assemble your own real data. Please consult the docs for many of the more powerful features of ipyrad including reference sequence mapping, assembly branching, and post-processing analysis.