Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
commit a98d35a5d38298fa68a83aecaf80b1cb9023b5a5
Author: McKay <mbowcut@gmail.com>
Date: Mon Apr 15 14:30:55 2024 -0600
Squashed commit of the following:
commit 06f48ed73228580cfedaab389a6db55a62456b97
Author: McKay <mbowcut@gmail.com>
Date: Mon Apr 15 14:02:58 2024 -0600
c2pro installation in dockerfile
commit 38dd5150a785e65edf7308bed35001b49bbbf017
Author: McKay <mbowcut@gmail.com>
Date: Mon Apr 15 13:20:46 2024 -0600
removed &&
commit ad38cee6ede27affaae6862173e912c999f32ce1
Author: McKay <mbowcut@gmail.com>
Date: Mon Apr 15 12:12:12 2024 -0600
moved d3 import to end
commit c2ba22f35c3e0a7775b3b89405c3c5ca38b3c4ee
Author: McKay <mbowcut@gmail.com>
Date: Mon Apr 15 12:11:03 2024 -0600
removed duplicate imports
leave d3 in bottom
plotly at top
commit 44cbe598affd5176d3209fd1901db0d0c438f625
Author: McKay <mbowcut@gmail.com>
Date: Fri Apr 12 16:07:18 2024 -0600
fixed batch rendering for d3
commit 418a6205ce52d8eb45799b34bcb47e3e5372d726
Author: McKay <mbowcut@gmail.com>
Date: Fri Apr 12 15:47:45 2024 -0600
fixed d3 plot 2b rendering
commit d4e00703ff6f023606505b787e5ddc31772d9e8c
Author: McKay <mbowcut@gmail.com>
Date: Wed Apr 10 15:52:05 2024 -0600
move C2Pro install before app run
commit e8f1947a3e5e5106d74f9200a6dac93616b171bd
Author: McKay <mbowcut@gmail.com>
Date: Tue Apr 9 17:21:40 2024 -0600
fixed guardrails, paritals path
commit 0a99c237b66970053a82221dba4b5aa6c2d2b568
Author: McKay <mbowcut@gmail.com>
Date: Tue Apr 9 13:33:40 2024 -0600
fastp, htmx, jquery dependencies
commit 62e8e66f62ddc226a470e82ee761279fb957c71d
Author: McKay <mbowcut@gmail.com>
Date: Tue Apr 9 12:15:49 2024 -0600
removed commented code
commit 11fb95e02f6133df827798098765b07043723a4f
Author: McKay <mbowcut@gmail.com>
Date: Tue Apr 9 11:19:58 2024 -0600
reports changes
commit 3220cd8c6c031c1710c72c9cf0eb7d6070757bd3
Author: McKay <mbowcut@gmail.com>
Date: Mon Apr 8 15:50:54 2024 -0600
Squashed commit of the following:
commit 53fecf71977f10c0d643887bf110cf7cbf044b8e
Author: Sam <snic9004@gmail.com>
Date: Thu Apr 4 15:35:39 2024 -0600
Squashed commit of the following:
commit 6f4b0ad885e1d72413a034bf7abaaa0360a3b0c4
Author: Samuel Nichols <Snic9004@gmail.com>
Date: Thu Apr 4 15:18:09 2024 -0600
Batch d3 clean (#55)
* imports C2Pro plots if available
* added --use_matplotlib flag
* added C2Pro
matched api funciton signatures
* added api args for plotly
* added **kwargs
* renamed config to custom_config, more specificity
* added backend flag for plotly kaleido
* added pro_installed boolean for templates, added plotly dependency to report templates
* Squashed commit of the following:
commit c909ea3b34e87ce637e00dac075d2bb2f8bfb954
Author: McKay <mbowcut@gmail.com>
Date: Thu Feb 15 15:55:23 2024 -0700
added plotly dependency for pro
commit 76b3601f6a0144f100266153f1c999e0c5de65de
Author: Samuel Nichols <Snic9004@gmail.com>
Date: Fri Jan 12 09:56:19 2024 -0700
Squashed commit of the following:
commit 603f2eff9d1aa21ae95f3e134da303b8018d3a33
Author: Samuel Nichols <Snic9004@gmail.com>
Date: Fri Jan 12 09:48:20 2024 -0700
fix guardrials partial
commit 22fc03183a8070c30dfb74d5c23575ac19019855
Author: Samuel Nichols <Snic9004@gmail.com>
Date: Fri Jan 12 08:54:01 2024 -0700
Add guardrail partial
commit e55f6b21972b578261bc5a864ce1d653d98f9e34
Author: Samuel Nichols <Snic9004@gmail.com>
Date: Mon Jan 8 07:50:59 2024 -0700
Functional guardrails, needs reports update
commit 6e968e9699ed59a47d88191d03768e042d8b60a4
Merge: 32b49685 e948ce10
Author: Samuel Nichols <Snic9004@gmail.com>
Date: Mon Dec 18 13:34:36 2023 -0700
Merge branch 'guardrails-clean-history' of https://github.com/edilytics/CRISPResso2 into guardrails-clean-history
commit 32b49685da320501dad2b0ebbb57887b66220ba8
Author: Samuel Nichols <Snic9004@gmail.com>
Date: Fri Dec 15 15:27:04 2023 -0700
Include guardrail functions
commit 4e309cf6f732565d635de3d4c5d074ada3027e2d
Author: Cole Lyman <cole@colelyman.com>
Date: Mon Dec 18 10:51:55 2023 -0700
Refactor to use CRISPRessoReports module
commit e648dc087c0055bc5d2fca13c64071a371dea941
Author: Cole Lyman <cole@colelyman.com>
Date: Mon Dec 18 10:51:11 2023 -0700
Add CRISPRessoReports subtree
commit e948ce107ebb0d1d99010ed12e937f34b5e607d4
Author: Samuel Nichols <Snic9004@gmail.com>
Date: Fri Dec 15 15:27:04 2023 -0700
Include guardrail functions
commit d33c748871a625facfe8d792e29c77ab9779138f
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Tue Nov 7 16:31:06 2023 -0700
Include parameter --assign_ambiguous_alignments_to_first_reference in readme
commit a1435f7f491a6a61434f3051e39f39a4c9bf1edc
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Wed Oct 11 17:17:30 2023 -0600
Enable quantification by sgRNA (#348)
This PR includes:
- storing the sgRNA-specific editing locations in the crispresso2_info object. Previously, each amplicon would record the indices of quantification windows across the guide, but not for individual guides. This stores the information for each guide in crispresso2_info['results']['refs'][reference_name]['sgRNA_include_idxs']
- a script (count_sgRNA_specific_edits.py) to parse through an allele table output from a completed CRISPResso run (`--write_detailed_allele_table` flag required) to count edits in each sgRNA separately.
I don't have a good double-edited sample handy, but it can be run on the demo HDR data [hdr.fastq.gz](http://crispresso.pinellolab.org/static/demo/hdr.fastq.gz) using the command:
```
CRISPResso -r1 hdr.fastq.gz -a acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggtta -e acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcaCctgactccGgaggagaagtctgccgttactgcGctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttggtatcaaggtta -c atggtgcatctgactcctgTggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcag -g TGCACCATGGTGTCTGTTTG,GATGAAGTTGGTGGTGAGGCCC --write_detailed_allele_table -n hdr3 -p max -gn guide1,guide2
```
```
python CRISPResso2/scripts/count_sgRNA_specific_edits.py -f CRISPResso_on_hdr3
```
This produces:
```
Processed 25000 alleles
Reference: Reference (2391/23415 modified reads)
UNMODIFIED: 21024
MODIFIED guide1: 2359
MODIFIED guide2: 32
Reference: HDR (856/1577 modified reads)
UNMODIFIED: 721
MODIFIED guide1: 854
MODIFIED guide1 + guide2: 1
MODIFIED guide2: 1
```
commit 2e3da02fdbed2fa8ae02a277763d65a502459827
Author: Cole Lyman <Cole@colelyman.com>
Date: Tue Oct 10 15:29:08 2023 -0600
changed tuple to list for matplotlib change (#31) (#346)
Co-authored-by: mbowcut2 <55161542+mbowcut2@users.noreply.github.com>
commit cd3c332135fe4db0f9218e3d87263d5c65838ed9
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Sun Oct 1 01:54:46 2023 -0600
rename script to camel case
commit 7c719d65fb36ac7654db9040f226564ea28fcab9
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Sun Oct 1 01:53:44 2023 -0600
Add new script for counting high quality bases
commit f97cd2795e89464bcc9321ccfdbca3e6af2bcb4f
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Sep 14 15:15:30 2023 -0600
Prime editing alignment params (#336)
Adds two parameters to control alignment of pegRNA components: --prime_editing_gap_open_penalty and --prime_editing_gap_extend_penalty.
CRISPResso checks to see whether the pegRNA spacer and extension sequence are in the correct orientation, but sometimes they could align in the incorrect orientation with a higher score (e.g. via insertion of multiple gaps, whereas a single long gap would be preferred). Introducing these two parameters allows users to adjust the alignment parameters specifically for these prime-editing checks without adjusting the global alignment parameters which will be applied to reads that are aligned to the WT reference/prime-editing reference sequences.
The new prime_editing_gap_open_penalty is set to -50, a higher gap open penalty than the default needleman_wunsch_gap_open penalty (-20). This commit breaks backward-reproducibility, but mostly in the checking of pegRNA component orientation - so previously some CRISPResso runs would have failed and produced an error, but now they will (hopefully) succeed. To achieve complete backward reproducibility, add the flag --prime_editing_gap_open_penalty -20 to runs.
commit 64cbf36dae85cffa2c15e73f2a7ee8aa1077d917
Author: Cole Lyman <Cole@colelyman.com>
Date: Thu Sep 7 16:43:30 2023 -0600
Fix samtools piping (#325)
* Remove samtools pipe stderr to stdout
Sometimes some of the libraries that samtools depends on don't have the correct
version information, and as such samtools will report this to stderr when run.
Because we pipe the output of samtools, we expect it to be valid SAM format, but
when these library version messages are reported, it breaks CRISPRessoWGS.
* Remove extra spacing at end of lines and add missing comma in WGS
* Log stderr from samtools in CRISPRessoWGS
commit 8feff4101f27406d9d88ace97d31a518276bff3f
Author: Cole Lyman <Cole@colelyman.com>
Date: Fri Sep 1 09:43:56 2023 -0600
Replace link to CRISPResso schematic with raw URL in README (#329)
* Replace link to CRISPResso schematic with raw URL
* Add new lines to the beginning of unordered lists
commit 2e9e6bff5bcc536d5e2ba1440d1ab96d9d47efd6
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Aug 10 00:52:12 2023 -0600
Try to unbreak CircleCI
commit ae5b95246cb0f6d66c4cbfb50cf8f5a9626b0827
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Aug 10 00:17:27 2023 -0600
Center command line text messages
commit 4d9c71ecf2248c9bb1e10430178dc318b6621c8b
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Aug 10 00:17:07 2023 -0600
Fix bug in prime-editing scaffold-incorporation plotting
If read is too short, scaffold incorporation detection will fail because it will check beyond the length of the read.
commit 2b36a1a5c35e8a93516ce8baf464595615e0f402
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Wed Aug 9 15:29:48 2023 -0600
CRISPRessoPooled --compile_postrun_references bug fixes
commit 3e04d1d402bcf95edd39fc7c8c9af61bb380f9db
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Tue Aug 8 23:30:15 2023 -0600
Fix missing ' in Pooled --demultiplex_only_at_amplicons
commit 06af527f9e2020c5cf251e7f1cec0b1eca1c1664
Author: Cole Lyman <Cole@colelyman.com>
Date: Mon Jul 24 10:47:46 2023 -0600
Sort pandas dataframes by # of reads and sequences so that the order is consistent (#316)
* Make sorting stable
* Including c files
* Sort by #Reads instead of %Reads to avoid floating point errors
---------
Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
commit de05533b3511a84f3b6b14fc2ef64db041613261
Author: Cole Lyman <Cole@colelyman.com>
Date: Thu Jul 6 13:54:45 2023 -0600
Fix multiprocessing lambda pickling (#311)
* Fix running plots in parallel
The reason the plots were running slower before this change is because I was
calling the plot function, not passing it to `submit`. So it was essentially
running in serial, but worse because it was still spinning up/down the
processes.
* Fix multiprocessing lambda pickling (#20)
* Refactor process_futures to be a dict
This makes debugging much easier because you can associate the arguments to the
future with the results.
* Fix the pickling error when running in multiprocessing
Only top-level functions (not lambdas) can be pickled to use in multiprocessing
pools, thus the lambdas are converted to a regular function.
* Further fixes to pickling multiprocessing error (#21)
* Refactor process_futures to be a dict
This makes debugging much easier because you can associate the arguments to the
future with the results.
* Fix the pickling error when running in multiprocessing
Only top-level functions (not lambdas) can be pickled to use in multiprocessing
pools, thus the lambdas are converted to a regular function.
* Use Counter instead of defaultdict in CRISPRessoCORE
* Update process_futures to dict in Batch and Aggregate
commit ebb016dff46c280dce8c3c09e8ac0e0cc25d4d74
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Mon Jul 3 17:12:09 2023 -0600
Enable CRISPRessoPooled multiprocessing when os allows multi-thread file append
commit 7285da0e987b77b72c8885bb35940e0f50c146bd
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Fri Jun 23 16:50:33 2023 -0600
Fix print bug for invalid fastq
commit 9acdeac67441f9a1d55ac94b153bcb68fb89b92c
Author: kclem <k.clement.dev@gmail.com>
Date: Wed Jun 21 16:03:48 2023 -0600
Slugify before creating filename - replaces invalid characters in batch names with _
commit f97e29c67de4c80b8d6b9cf334f363be4b514ade
Author: Cole Lyman <Cole@colelyman.com>
Date: Wed Jun 21 14:43:43 2023 -0600
Add verbosity argument to CRISPRessoAggregate (#18) fixes #306 (#307)
* Add verbosity argument to CRISPRessoAggregate (#18)
* Allow for amplicon and guide seqs to be some variant of NA in batch (#19)
This was discovered when attempting to infer amplicon sequences in batch mode on
the web interface, NAs were supplied for the amplicon sequences to the sub
CRISPResso commands.
commit 32e1e9797da5c3033cdc588e92f06b8813961953
Author: Mark Clement <u0351481@notchpeak30.int.chpc.utah.edu>
Date: Wed Jun 21 14:01:00 2023 -0600
Allow for interrogation of overlapping sgRNA sites
commit 7248ba8c4deee125ad1ec12fdf1294a84d5f6f93
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Mon Jun 12 12:16:47 2023 -0600
Check input fastq file format
Asserts input format of fastq files - including if gzipped files are missing the gz suffix.
commit 83c8ab8f462e7d8c1d04c08c1a398b874f517251
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Mon Jun 5 13:41:55 2023 -0600
Fix CRISPRessoArgParser
commit 14a2c8577f566e1b72d5f4e72cd6cd22079610be
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Mon Jun 5 13:29:31 2023 -0600
Cosmetic updates for command-line use
- version bump to 2.2.13
- If no args are provided, the command line version will print out an abbreviated help message
- parameters can be excluded from CRISPRessoArgParser
commit 1cd54bc1d03360c3d8121ba9e66b3589fe1cf252
Author: Cole Lyman <Cole@colelyman.com>
Date: Thu May 11 14:31:47 2023 -0600
Fix multiprocessing error, don't start pool when only using single thread (#302)
* Update README to have consistent use of `--base_editor_output` (#16)
* Add files via upload
* Only start process pools when using multiple processes
This is mainly to solve the issue when running on AWS Lambda, but this should
improve single core performance overall.
---------
Co-authored-by: Kendell Clement <k.clement.dev@gmail.com>
commit 92a705c939b370373a70cf6ae9f1616de33288b9
Author: Cole Lyman <Cole@colelyman.com>
Date: Thu May 11 14:31:06 2023 -0600
Update `base_editor` parameters in README and add Plot Harness (#301)
* Update README to have consistent use of `--base_editor_output` (#16)
* Add files via upload
---------
Co-authored-by: Kendell Clement <k.clement.dev@gmail.com>
commit 7d46c4490235df45c5546b1b470e4e6a99727031
Author: Cole Lyman <Cole@colelyman.com>
Date: Wed May 10 15:41:33 2023 -0600
Clarify CRISPRessoWGS intended use (#303)
* Update README to have consistent use of `--base_editor_output` (#16)
* Add sample plotting jupyter notebook
* Add clarifying info to CRISPRessoWGS description
Clarify WGS usage
commit 833a701787bb47674b3e921c38cac6189c775cf7
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu May 4 17:02:46 2023 -0400
Remove debug print statements
commit 712eb2a11825e8d36f2870deb12b35486bd633fb
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu May 4 16:40:07 2023 -0400
Allow dashes in filenames resolve #73
commit a439f094745b2b5e7f032f0777d4c67e6d6f93c5
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Sat Apr 22 23:41:58 2023 -0400
Raise exceptions from within futures in plot_pool
commit 7e807a60de2a9d18bccd034b87106ceaf7153338
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Sat Apr 22 23:38:56 2023 -0400
Fix future pandas indexing warning
Pandas error was "FutureWarning: Calling float on a single element Series is deprecated and will raise a TypeError in the future. Use float(ser.iloc[0]) instead"
commit 304a92aa7a7ef8c705cb070dce25d9a2e5745ba9
Author: Cole Lyman <Cole@colelyman.com>
Date: Thu Apr 20 13:59:27 2023 -0600
Remove debug print statements fixes #295 (#297)
The format string option used here is only available in Python version >=3.8.
commit 478c06f784603e96d20f96e91993fdcc4ac35c8a
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Apr 13 12:09:26 2023 -0400
Update plotCustomAllelePlot.py script for #292 (#293)
Update type of 'max_rows' param to int
Fix location of 'args' in crispresso2_info object
commit bcdae39e05d530f4a4e78738c3b30f7664981919
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Mon Mar 27 13:18:34 2023 -0400
Update pooled parameter format
commit 546446e36e7e68b527767d6c31ec341a49df2059
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Tue Feb 14 16:26:23 2023 -0500
Fix running plots in parallel (#286)
The reason the plots were running slower before this change is because I was
calling the plot function, not passing it to `submit`. So it was essentially
running in serial, but worse because it was still spinning up/down the
processes.
Co-authored-by: Cole Lyman <cole@colelyman.com>
commit d75f32a2eb5aeaaee866c09e5655a3e27af8b1a1
Author: kclem <k.clement.dev@gmail.com>
Date: Fri Feb 10 15:45:15 2023 -0500
Fix #283 to avoid filename collisions
Previously, amplicon names longer than 21bp were truncated, but the check for uniqueness wasn't working, so it would overwrite some plot files. This fixes the filename collision and enforces uniqueness in reference filename prefixes. Thanks @mbiokyle29
commit e577318006cd17b2725bd028e5e56634c6eb829a
Author: kclem <k.clement.dev@gmail.com>
Date: Mon Feb 6 16:37:25 2023 -0500
Case-insensitive headers accepted in CRISPRessoPooled
commit d34927620a4a6126a9988b3041e76f60728abbfe
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Tue Jan 31 13:48:33 2023 -0500
Fix print statement in CORE
commit ee88b7ed89c395f68225a50dea44a2ad69d5e9a5
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Tue Jan 31 13:22:51 2023 -0500
Version bump to 2.2.12
commit 1d4679c72d0c8b4154317c9aff5179217198e2d7
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Tue Jan 31 13:01:31 2023 -0500
Status Updates + Pooled Mixed Mode Update (#279)
* Implement logging handler to overwrite the latest log status to file
* Add StatusHandler to CRISPRessoCORE log
This will take the latest log output and write it to a file (`status.txt`), the
catch being that with each log the file is overwritten so that one can easily
tell where CRISPResso currently is and what the error is (if any). These changes
include some slight refactoring in order to accomodate any potential parameter
exceptions.
* Add StatusHandler to CRISPRessoBatch and refactor `logger.warn` to `warn`
* Add StatusHandler to CRISPRessoPooled and a little refactoring
* Implement `percent_complete` to the status log
* Add StatusHandler to CRISPRessoAggregate log
* Add StatusHandler to CRISPRessoCompare log
* Add StatusHandler to CRISPRessoPooledWGSCompare log
* Add StatusHandler to CRISPRessoWGS log
* Rename `status.txt` to `CRISPResso_status.txt`
* Modify status log names to match the tool they are generated from
* Add percent_complete stages to CRISPRessoCORE
These also include log statements of each plot that is being generated as well
as fixing some variable name collisions with `ind`.
* Format the percentage in the log to be 2 decimal places
* Change all plotting logs from `info` to `debug` and simplify progress
This refactors how the progress of the plots is calculated, making it much
simplier. Before this change we would of had to keep track of the number of
times `percent_complete` was output, but now it simply updates the percent
complete after each amplicon is finished processing. Hopefully this will make
things easier to mantain even though it will be a little less "accurate" (not
sure how accurate the original implementation was...).
* Implemented shared console log handler across all CRISPResso* calls
This allows for easy changes to logging formatting, which was inspired by having
to change the default logging level. The default logging level needs to be set
at `logging.DEBUG` in order for the debug log statements to not be ignored for
the running and status logs.
* Add ability to set the verbosity level to each CRISPResso* tool
This allows users to set a verbosity level between 1 and 4 using the
`-v`/`--verbosity` CLI parameter. If the `--debug` flag is present, then the
level will default to 4, being the most verbose.
* Implement showing the last seen `percent_compelte` when none is provided
* Keep track of and log when multiple parallel runs are completed
These changes modify `CRISPRessoMultiProcessing.run_crispresso_cmds` such that
we can now display when a run is completed. This potentially breaks how
signals and interupts are handled with multiple runs happening, but this needs
to be reviewed.
* Add debug and percentage complete to CRISPRessoBatch
* Add percent complete to CRISPRessoPooled
* Add debug and percent_complete message to CRISPRessoAggregate
* Add `percent_complete` to CRISPRessoCompare
* Add `percent_complete` to CRISPRessoPooledWGSCompare
* Add status and `percent_complete` to CRISPRessoMeta
* Add `verbosity` arguments to CRISPRessoCompare and CRISPRessoPooledWGSCompare
* Fixing documentation to match pooled headers
* Header removal bug fix change documentation to guide_seq
* Update documentation and help feature for CRISPRessoPooled
* Remove extra newlines from CRISPRessoPooled -h
* Make variable names as clear as my firstborn child's name
* Update one more variable name
* Fix bug to flow CRISPRessoPooled options to sub command
* Make amplicon file args variable name clear
* Update how parameters are set and retrieved from parameter object
The refactor in the previous commit changed the type of the arguments to a
dictionary which doesn't have the parameters as attributes, and this commit
fixes that error.
* Add note in output header for change in default CRISPRessoPooled
In the next release (2.3.0) the `--demultiplex_only_at_amplicons` will be the
default when running in mixed-mode. This is to allow for inexact alignments of
the reads and the amplicons to the genome. For more context, see this issue
https://github.com/pinellolab/CRISPResso2/issues/276
* Clarify the verbosity parameter help message
* Separate out parameters to `normalize_name` in CRISPRessoCORE
* Separate out parameters to `normalize_name` in CRISPRessoWGS
* Separate out parameters to `normalize_name` in CRISPRessoPooled
* Separate out parameters to `normalize_name` in CRISPRessoCompare
* Fix bug in CRISPRessoPooled by replacing `database_id` with `normalize_name`
* Refactor `run_crispresso_cmds` to not require a `logger`
This commit implements the functionality to make the `logger` object optional by
seeing which module called the `run_crispresso_cmds` function and obtaining the
correct object from that module name.
The function also immediately returns when no commands are passed to it.
* Add amplicon name to plotting debug statements in CRISPRessoCORE
---------
Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan>
Co-authored-by: Cole Lyman <cole@Coles-MacBook-Pro-2.local>
Co-authored-by: Cole Lyman <cole@colelyman.com>
Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
commit ff7eca76e6a3a08af4ac18ac4e88d20f2a06b1f9
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Jan 26 15:27:27 2023 -0500
CRISPRessoPooled custom header fix (#278)
* Fixing documentation to match pooled headers
* Header removal bug fix change documentation to guide_seq
* Update documentation and help feature for CRISPRessoPooled
* Remove extra newlines from CRISPRessoPooled -h
* Make variable names as clear as my firstborn child's name
* Update one more variable name
Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
commit 104866e1080c973bb025d1a5ba59b19dca1658af
Author: Cole Lyman <Cole@colelyman.com>
Date: Thu Jan 5 14:00:26 2023 -0700
Fix deprecated numpy type names (fixes #269) (#270)
In the most recent version of numpy (1.24) some of the types have been
deprecated. This commit fixes these errors.
commit 58a8e42df88b66fad6b4f6ad04a5b9d9d43d01b4
Author: Cole Lyman <Cole@colelyman.com>
Date: Thu Jan 5 06:49:35 2023 -0700
Add snippet about installing CRISPResso2 via bioconda on Apple silicon (#274)
I have suffered enough trying to debug my installation, so hopefully this helps
someone else.
Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan>
commit b9851e98104602eb78c2b384105267624295e9d3
Author: Cole Lyman <Cole@colelyman.com>
Date: Thu Dec 22 13:30:23 2022 -0700
Fix bug when pooled bam is input (#265)
This change checks to see if a bam file was input, and if so it doesn't try to
remove any intermediate files because there aren't any.
Co-authored-by: Cole Lyman <cole@coles-mbp-2.lan>
commit b822612642043e75a19042941f69b457ce51f517
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Mon Dec 19 15:26:45 2022 -0500
Delete vscode settings
commit b99aa624dec68ef7d19264340ce0cafa829625f4
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Mon Dec 19 13:29:14 2022 -0500
Clarify input param help for pooled bam
commit 3fae1e8b821ec6b1890bff6561fa8fa67dc49a04
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Mon Dec 19 13:28:54 2022 -0500
Fix #235 - Cigar string is * if read unaligned
Previously, the bam would set the cigar string to 0 if the read was unaligned. This breaks the sam->bam conversion and causes the errors in #235.
commit c65ba07dc5a983453cdf7bb1e27005230dac6f1b
Author: Cole Lyman <Cole@colelyman.com>
Date: Thu Dec 8 13:48:17 2022 -0700
Add deprecation notice (#260)
* Add FLASh and Trimmomatic deprecation notice to CLI output
* Add Edilytics email address to CLI output
commit 2a30e5a45f5350ee7c6435bce1cd4edc4d31668a
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Tue Dec 6 12:16:19 2022 -0500
Format filterReadsOnSequencePresence script
commit 9d764414edd88a46ad5e4f496e4f1c8d5d60ce3e
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Fri Dec 2 22:12:54 2022 -0500
Clarify default CRISPRessoPooled settings for use_legacy_bowtie2_options_string
commit 9ddea40f7f02b546941ddaa4c71fc5283075051a
Author: kclem <k.clement.dev@gmail.com>
Date: Mon Nov 14 10:33:04 2022 -0500
Add check for prime editing extension sequence in prime edited sequence
if the user specifies the prime_editing_override_prime_edited_ref_seq, it could not contain the extension seq (if they don't provide the extension seq in the appropriate orientation), so check that here. Extension sequence should be provided reverse-complement to the prime edited sequence.
commit 152f2dd5001da7090641ee8a1326bde9f7e8104e
Author: kclem <k.clement.dev@gmail.com>
Date: Wed Nov 9 11:53:41 2022 -0500
Version bump to 2.2.11a
commit 9ed356e3a0c6c316d0860d121772f80ddca6de1d
Author: kclem <k.clement.dev@gmail.com>
Date: Wed Nov 9 11:47:30 2022 -0500
Add param to override prime editing sequence checks
CRISPResso checks that prime editing guides are provided in the proper orientation (e.g. pegRNA 3'->5', spacer sequence 5'->3') and checks these orientations by alignment. Sometimes, the alignment can be better in the opposite direction, and this parameter allows these checks to be overridden. Otherwise, these checks would halt the program and produce the output 'The prime editing pegRNA spacer sequence appears to be given in the 3\'->5\' order. The prime editing pegRNA spacer sequence (--prime_editing_pegRNA_spacer_seq) must be given in the RNA 5\'->3\' order.'
commit 39dd80afb98a22b7edb6f801c363d86bb77eeb5b
Author: kclem <k.clement.dev@gmail.com>
Date: Wed Nov 9 10:06:51 2022 -0500
Update filterReadsOnSequencePresence.py
commit fe55526927e3fb6e17c9a8a6f59c7057bc1e14eb
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Mon Nov 7 22:25:16 2022 -0500
Add script to filter input based on sequence presence
commit 713e57a19c35180035ca35e11a5820065eda0198
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Tue Oct 18 16:02:26 2022 -0400
Allow spaces in read names for CRISPRessoWGS
commit 39ce008bdddccdd8229c0ba185dce78bc2f66968
Author: Cole Lyman <Cole@colelyman.com>
Date: Sat Oct 8 21:09:58 2022 -0600
Fix typo of CRISPResssoPlot when plotting nucleotide quilt (#250)
commit 6a2b342c8503b7327c0a2414edfbd16912d60ca5
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Sat Oct 8 23:08:47 2022 -0400
Batch amplicon plots (#251)
* Error out if HDR amplicon matches existing amplicon
* Add check for amplicon sequence uniqueness
* Fix bug with bam_input not having bam_output
* Test for no returned lines in auto mode, version bump to 2.2.11
* Fix pandas deprecation of df.append
commit 726b2b93d6e419a1b0aa6a968c97edc55b4cc5a8
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Oct 6 16:32:02 2022 -0400
Fix CRISPRessoBatch plot pool bug when plots are suppressed
commit 7e5049c4dfb88cbc87c91935a91d1f51120a10c2
Author: Cole Lyman <Cole@colelyman.com>
Date: Wed Sep 21 21:04:51 2022 -0600
Fix batch quilt plot name (#249)
This fixes an incorrectly named allele quilt plot input in CRISPRessoBatch.
commit 1821ca5029c5a1485733f13ab3f2048b4f1fa04e
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Sep 15 15:49:08 2022 -0400
Version bump to 2.2.10
commit c5f79aebfc1ae209f4ee320df250eed89a02787c
Author: Cole Lyman <Cole@colelyman.com>
Date: Wed Sep 14 14:24:55 2022 -0600
Parallel plot refactor (#247)
* Fix duplicate plotting in CRISPRessoBatch aggregate
* Refactor mulltiprocessing plots in CRISPRessoBatch
* Refactor multiprocessing plots in CRISPRessoCORE
* Refactor multiprocessing plots for CRISPRessoAggregate
commit 4ed5e24e6cc1dd8068e2391573ae2438acd32db2
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Tue Sep 13 14:12:11 2022 -0400
print files in curr dir if Aggregate can't find files
commit ce25bc06f29988e7a10afd0b6a09ba0caf0950e0
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Mon Sep 12 10:32:57 2022 -0400
Spelling typo
commit c15f01c75083403f17c58c121b2afe97e9f2a1ec
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Tue Sep 6 17:49:52 2022 -0400
Add helper function to create alignment scoring matrix
New scoring matrix can be created using CRISPResso2Align.make_matrix()
commit c80f82838c5a228b79ad4484092877cfee08e02c
Author: Cole Lyman <Cole@colelyman.com>
Date: Mon Aug 22 18:28:33 2022 -0600
Add `zip_output` (#240)
* Making zip of results
* Zip command added, if zip is true place_report_in_output_folder is also true, zip removes all files while zipping
* Adding --zip to compare and pooled/wgs compare
* Add more formatting changes to CRISPRessoShared
* Refactoring propagate_crispress_options so only one version exists
* Zip added to arguments_to_ignore and warning added when changing arguments
* Restore styling
* Update README to include --zip
* Rename --zip to --zip_output
* Change --zip to --zip_output in CompareCORE and PooledWGSCompareCORE
* Bug fix arg to args
Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
commit 5de3d7286d8e33c7cf4d3615fce715806e72f511
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Aug 11 21:42:34 2022 -0400
Fix fix to aggregate for CRISPRessoWGS
commit a2294c266f43b14969a5d6474076f31a77a57173
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Aug 11 21:40:50 2022 -0400
Fix bug in aggregate for WGS
commit 7ce3eb4abe4b8ceac933272ac9cb16a8bedf26a3
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Mon Aug 8 21:53:45 2022 -0400
Update CRISPRessoWGS to allow non-word characters in region names
commit 040ac0033d6e250f4e3a412101874cf5e914e08a
Author: kclem <k.clement.dev@gmail.com>
Date: Mon Aug 8 16:04:59 2022 -0400
Enable processing of cram files by CRISPRessoWGS
Adds --reference to samtools view when viewing cram files
commit cf112a0caba8789e28530cc09171285ec6ea9b4c
Author: kclem <k.clement.dev@gmail.com>
Date: Mon Aug 8 14:55:46 2022 -0400
Auto amplicon detection for interleaved input
Enables processing of interleaved fastq files for guess_guides and guess_amplicons, as well as get_most_frequent_reads. When interleaved input is present, the input is first separated into R1/R2 files, then processing is performed.
commit 4ba524dc7b947feca8a0f743837844f9febc2171
Author: Cole Lyman <Cole@colelyman.com>
Date: Thu Aug 4 11:32:11 2022 -0600
Potential fix for aggregate plots in Batch mode (#237)
commit 6097a8a104d3f156ef7c08e196ac37e32bf04c71
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Jul 21 22:45:48 2022 -0400
Fix pct_vectors in crispresso2_info json object
commit 65a079d86d6f386793397398f839c46014b54543
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Wed Jul 20 23:46:37 2022 -0400
Fix more readme spelling bugs
commit e817376ecd54cdea1f29e303ca25b9e7d1d38333
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Wed Jul 20 23:42:23 2022 -0400
Fix bug in readme spelling
commit 49740ba1d66ed6d13a9e154b8b17bc8b5186581d
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Wed Jul 20 16:10:09 2022 -0400
Fix loading of crispresso info from WGS and Pooled
commit b68a43271115251b18e8955e285ccc18f549e8cd
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Jul 14 14:11:04 2022 -0400
Add plotly to dockerfile
commit b0b7d41d697304d0d5fc93e3346c9de1b98ba41d
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Jul 14 14:10:00 2022 -0400
Fix #231 Allow N's in bam output (Try 2)
commit c460b3e73fd06a230dbac2e37c86b833144ebf94
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Jul 14 14:09:10 2022 -0400
Revert "Fix #231 Allow N's in bam output"
This reverts commit 2f6ad1dbe05210af9ccc1b1f17783cd212a888d3.
commit 2f6ad1dbe05210af9ccc1b1f17783cd212a888d3
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Jul 14 13:52:37 2022 -0400
Fix #231 Allow N's in bam output
commit 0a2419e518dc9b3520058c3927f98b31cd51347e
Author: Cole Lyman <Cole@colelyman.com>
Date: Fri Jul 8 21:10:01 2022 -0600
Fix bug when name is provided instead of amplicon_name in pooled input file (#229)
Also, raise an exception (instead of incorrectly executing) when there are not
enough matched parameters in the pooled input file.
commit cb58212379803788c04ca5793baaa760cbbeaa81
Author: Cole Lyman <Cole@colelyman.com>
Date: Fri Jul 8 21:09:49 2022 -0600
Fix bug when comparing two samples with the same name. (#228)
commit e8a796f5f451409cbafed4404dfba4b6b8a124ca
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Jun 23 21:30:23 2022 -0400
Version bump to 2.2.9
commit 632143ddedea48bab9229baeb4bf3ea4d1f658d6
Author: Cole Lyman <Cole@colelyman.com>
Date: Mon Jun 20 19:53:14 2022 -0600
Don't run global frameshift plot when there are no reads (#226)
When there are no reads (i.e. global_MODIFIED_FRAMESHIFT +
global_MODIFIED_NON_FRAMESHIFT + global_NON_MODIFIED_NON_FRAMESHIFT == 0) there
was a bug when trying to compute the pie chart, because all of the values in the
pie chart are 0. This fix, will make sure that there is at least one read in
order for the plot to bee constructed properly.
commit 4bb06218e835d2624d53fd401542caef6f8a3a55
Author: kclem <k.clement.dev@gmail.com>
Date: Fri Jun 3 16:57:02 2022 -0400
Improvements for guide inference in 'auto' mode
In 'auto' mode, a putative guide sequence is selected at the site of maximal editing. If the site of maximal editing happens near the end of the guide (e.g. base 0) many things will break (e.g. quantification windows, etc). This update excludes bases from being used to find the guide using the --exclude_bp_from_left and --exclude_bp_from_right parameters. At default, these parameters are 15bp, so the first and last 15bp would not be selected for the site of maximal editing and thus be the site of a guide sequence. In addition, the site of maximal editing must have 3x the magnitude over the background.
commit 9d64de187835b2553ad2b4374d32edab27f83645
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu Jun 2 20:22:25 2022 -0400
Update README.md
commit 6aafc5387986f5089ba55b68d128343d68052792
Author: Simon P Shen <sshen8@users.noreply.github.com>
Date: Tue May 31 17:42:53 2022 -0400
directory in quotes in batch cmd (#222)
Add quotes around output folder for folders that have spaces.
commit 432f163ac68b9a650d1fd326171aadc505ee87f4
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Tue May 24 23:38:36 2022 -0400
CRISPRessoBatch fills NA values in batch settings
NA values in CRISPRessoBatch are filled with the value from args - either the default value or the value from the command line args (if set)
commit 6de774adbad3aa8cd99d07b0ba7692984b356cd4
Author: kclem <k.clement.dev@gmail.com>
Date: Mon May 23 14:18:02 2022 -0400
Fix file naming bug for HDR outputs
In html file, figures 4e and 4f incorrectly referenced figure 4d. This fixes this bug.
commit b88fec0668a4082a12ead3d26582e86d829dd7cc
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Sat May 21 00:32:15 2022 -0400
For bam_output, fix bug that wrote unaligned lines twice
commit 3564e77ebcdedb4b01cc01dcca18ba3221fac67c
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu May 19 16:32:18 2022 -0400
Update README with CRISPRessoPooled headers and bam_output parameters
commit bc08d81f17cb1929d1c37a1773cffcf36fb12fe2
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu May 19 16:11:30 2022 -0400
Add more links to tools
commit 006c497a379ecd94b017a883a5db887861e1586a
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu May 19 16:08:14 2022 -0400
Add links to tools
commit dc8243373ad00d6bd467fc30c59942596ff0c5d6
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Mon May 16 21:38:06 2022 -0400
fastq_to_bam implementation (#219)
commit e88b6833977c6b2768299e0b2e7af623e3a9ae7c
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Sun May 8 02:14:13 2022 -0400
Fix bug for when guides don't agree in CRISPRessoAggregate
commit 7eb763116a8c60603f1cd654645215767ee8eb52
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu May 5 03:28:21 2022 -0400
Fix bug for case of empty summary plots in report generation
commit 0324fa67d14ed945f0c9531d9bcf73ebcf4ca042
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Thu May 5 03:28:02 2022 -0400
Create report for number of significant bases in CRISPRessoCompare
commit e3c9d0026a9ee6732f3ed6bdcf2a824850d7e66a
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Wed May 4 22:43:11 2022 -0400
Update pickle to json in readme and CRISPRessoPooledWGSCompare
commit 1553f7977c12bf1091a20ca55b878bccfb739b61
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Wed May 4 18:10:04 2022 -0400
Merge pull request #4 from pinellolab/master (#218)
commit bcecbfc047d294e26f381a6668e08cb4db24445c
Merge: 15b0e05b bb13e007
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Wed May 4 18:06:37 2022 -0400
Merge branch 'master' into master
commit bb13e007738d6e7a4909e01f03daff592f334f36
Merge: af4ab6e8 d0b41483
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Wed May 4 17:59:32 2022 -0400
Merge branch 'master' of https://github.com/edilytics/CRISPResso2
commit 15b0e05b9e03bbec5236e58776ddf9aa2f93180e
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Wed May 4 17:54:52 2022 -0400
2 flexible pooled input (#217)
* Batch type coerce and r2 file check
* Upgrade tabs for bootstrap5
* Update readme with additional pooled amplicon file headers
Co-authored-by: Samuel Nichols <Snic9004@gmail.com>
commit d0b41483bee704940ba60c58289f412b04c71659
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Wed May 4 13:43:43 2022 -0400
Update README.md
commit ce49fab5301cb73ba0daf6c765e350eb083c76f1
Merge: 5f909713 b913fcb4
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Wed May 4 13:40:30 2022 -0400
Merge pull request #3 from edilytics/2-flexible-pooled-input
Add flexibility to CRISPRessoPooled amplicon input by allowing headers. Also, prime editing and quantification window coordinate parameters can be passed to CRISPRessoPooled.
commit b913fcb402a8ba3106c3ff7913563a33d8d19fca
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Wed May 4 13:38:25 2022 -0400
Update CRISPRessoPooledCORE.py
Replace process to read header, increase flexibility for column order
commit 945bf31f16530b7ce25b89095b2c7005bf146117
Merge: 7b8f6788 5f909713
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Wed May 4 12:45:24 2022 -0400
Merge branch 'master' into 2-flexible-pooled-input
commit 5f9097133765736a7c2fe3c8e9b730845fed0b70
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Wed May 4 12:23:44 2022 -0400
Version bump to 2.2.8
commit c4a94ce0e06c6ebae13e128fbe6b708e635121c4
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Wed May 4 00:13:17 2022 -0400
Fix summary plot representation for multi reports
*fixed old reference to make_multi_report which called old summary plot format
* renamed summary_plot to summary_plots to reflect a dict with multiple plots
commit 62900e9ae6fa37ce99a04f12a63ed5c912f75042
Author: Cole Lyman <Cole@colelyman.com>
Date: Tue May 3 20:47:52 2022 -0600
Large aggregation (#192)
* Squashed commit of the following:
commit 8564eb03f0d9e62abf4b7528baf5c2ae296be8f9
Merge: f6ef62c 07cc7d8
Author: Kendell Clement <k.clement.dev@gmail.com>
Date: Tue Jan 11 16:20:15 2022 -0500
Merge branch 'indel-alignment-fix' of https://github.com/edilytics/CRISPResso2 into indel-alignment-fix
commit 07cc7d856ab3fcbbaa5381f17f29568192388887
Author: Cole Lyman <cole@colelyman.com>
Date: Fri Dec 10 15:29:59 2021 -0700
Fix bug in `find_indels_substitutions`
This bug occurred when there was a deletion at the end of a sequence, and was
thus not properly accounted for.
commit f6ef62cfdf909adac1b10ea86555cd218f8b2a74
Author: Cole Lyman <cole@colelyman.com>
Date: Fri Dec 10 15:29:59 2021 -0700
Fix bug in `find_indels_substitutions`
This bug occurred when there was a deletion at the end of a sequence, and was
thus not properly accounted for.
commit 7212f87f4be60057a6c848947ff6b5efde132a25
Author: Cole Lyman <cole@colelyman.com>
Date: Fri Dec 10 15:26:17 2021 -0700
Add a unit test for `find_indels_substitutions`
This unit test checks for deletions at the end of a sequence, which are
inherently outside of the include_indx_set window.
commit d50b4e903b973c71a275e31d470b40e59280ee13
Author: Cole Lyman <cole@colelyman.com>
Date: Fri Dec 10 15:03:22 2021 -0700
Fix a bug in `find_indels_substitutions`
The bug that this commit fixes is when an insertion occurs at the edge of the
include indexes. The trouble with this earlier was that it was using the `idx`
to calculate the size of the insertion, but the `idx` wasn't being incremented
anymore because it was outside of the include window.
commit 4db066f7bc333b7662a9232ac732ebb33ac3ace8
Author: Cole Lyman <cole@colelyman.com>
Date: Fri Dec 10 15:01:39 2021 -0700
Add test case for `find_indels_substitutions`
This test case is extracted from the CRISPRessoBatch integration test and
provides an example where there is an insertion at the edge of the include
index.
commit 3b3a7417f5bbd6c2785a2af54a47e01d2e820451
Author: Cole Lyman <cole@colelyman.com>
Date: Fri Dec 10 11:37:07 2021 -0700
Fix bug in CRISPRessoCompare where sample names were not properly set
This was a place where it was (partially) missed during the crispresso2_info
object refactoring.
commit e9f5eff3d95b676b5ee2e23371a5604f600d34b2
Author: Cole Lyman <cole@colelyman.com>
Date: Fri Dec 10 15:26:17 2021 -0700
Add a unit test for `find_indels_substitutions`
This unit test checks for deletions at the end of a sequence, which are
inherently outside of the include_indx_set window.
commit d4d45a918254ab19a7e7956e9e731389c6f36ecb
Author: Cole Lyman <cole@colelyman.com>
Date: Fri Dec 10 15:03:22 2021 -0700
Fix a bug in `find_indels_substitutions`
The bug that this commit fixes is when an insertion occurs at the edge of the
include indexes. The trouble with this earlier was that it was using the `idx`
to calculate the size of the insertion, but the `idx` wasn't being incremented
anymore because it was outside of the include window.
commit 13f00bb40239c83e6e5cf844561fdb7000d3d9ab
Author: Cole Lyman <cole@colelyman.com>
Date: Fri Dec 10 15:01:39 2021 -0700
Add test case for `find_indels_substitutions`
This test case is extracted from the CRISPRessoBatch integration test and
provides an example where there is an insertion at the edge of the include
index.
commit 659ae34e8fd106f7ecc163b5bea0b5a80ab0283c
Author: Cole Lyman <cole@colelyman.com>
Date: Fri Dec 10 11:37:07 2021 -0700
Fix bug in CRISPRessoCompare where sample names were not properly set
This was a place where it was (partially) missed during the crispresso2_info
object refactoring.
* Add parameter `--suppress_batch_summary_plots`
If many runs are run at the same time, batch summary plots may fail because they are too large for matplotlib. This parameter `--suppress_batch_summary_plots` allows individual runs to be plotted, but suppresses batch summary plots that may otherwise be too big.
* Pep formatting cleanup
* Add summary nucleotide plots to aggregate
* Aggregate plots are paginated
* Update CRISPRessoAggregateCORE.py
Remove max sample limit for plotting
* Add --max_samples_per_summary_plot to CRISPRessoAggregate
Parameterize the max number of samples to plot on each page of reports. Additional PDFs will be created with this number of samples on them.
* Add plotly function to plot an interactive heatmap
* Fix deprecated numpy type to suppress warning
* Add plotting of heatmaps to CRISPRessoAggregateCORE to summarize modification types
These heatmaps are interactive (zoomable and panable) and show for each sample
the percentage of insertions, substitutions, and deletions.
* Add the heatmap summaries to the CRISPRessoAggregate report
* Update Bootstrap to 5.1.3
This is mainly so that we can use the fullscreen modal functionality in this version.
* Move the plotly heatmaps to a Bootstrap modal
* Fix bug where plots were not filling up entire modal.
…- Loading branch information
