nodup bam #59

kirstyjamieson · 2018-11-27T20:39:53Z

Hi Jin,
Could you provide an example .json file for starting with nodup bam instead of fastq?

Thanks,
Kirsty

leepc12 · 2018-11-27T20:46:55Z

Remove any FASTQ definition ("atac.fastqs*") from your input JSON and add

    "atac.nodup_bams" : [ "rep1.bam", "rep2.bam" ],

kirstyjamieson · 2018-11-27T22:00:28Z

I'm getting an error:

[error] WorkflowManagerActor Workflow a7b66b90-77f3-47b9-afa6-d874bd8e21ab failed (during ExecutingWorkflowState): Job atac.spr:2:1 exited with return code 1 which has not been declared as a valid return code. See 'continueOnReturnCode' runtime attribute for more details.

{
"atac.pipeline_type" : "atac",
"atac.genome_tsv" : "test_genome_database/hg38_local.tsv",
"atac.nodup_bams" : [ "test_sample/induced/rep1/KJ064_R1_TRIM.trim.nodup.bam", "test_sample/induced/rep2/KJ065_R1_TRIM.trim.nodup.bam", "test_sample/induced/rep3/KJ066_R1_TRIM.trim.nodup.bam"],

"atac.paired_end" : true,
"atac.multimapping" : 4,

"atac.auto_detect_adapter" : true,

"atac.smooth_win" : 73,
"atac.enable_idr" : true,
"atac.idr_thresh" : 0.05,

"atac.enable_xcor" : true,

"atac.title" : "induced",
"atac.description" : "ATAC-seq on induced RPEs",

"atac.trim_adapter.cpu" : 1,
"atac.trim_adapter.mem_mb" : 4000,
"atac.trim_adapter.time_hr" : 1,
"atac.bowtie2_cpu" : 1,
"atac.bowtie2_mem_mb" : 4000,
"atac.bowtie2_time_hr" : 1,
"atac.filter_cpu" : 1,
"atac.filter_mem_mb" : 4000,
"atac.filter_time_hr" : 1,
"atac.macs2_mem_mb" : 4000,
"atac.macs2_time_hr" : 1,
"atac.ataqc.mem_mb" : 4000,
"atac.ataqc.time_hr" : 1

}

run.sh.txt
run.sh.o489151.txt

leepc12 · 2018-11-27T22:18:52Z

test_genome_database/hg38_local.tsv doesn't exist

Did you download genome database for test samples?

kirstyjamieson · 2018-11-27T23:24:21Z

Sorry, that was the wrong output. This is my current one:

run.sh.o499187.txt

leepc12 · 2018-11-27T23:46:11Z

We will look into this problem. Please do not enable_xcor until this problem is fixed.
Remove "atac.enable_xcor" : true, from your input JSON.

kirstyjamieson · 2018-11-27T23:50:11Z

Thanks. I also realized I sent the old run.sh. This is the current one.

#!/bin/bash
#$ -l arch=linux-x64
#$ -l h_rt=48:0:0
#$ -l mem_free=8G
#$ -S /bin/bash
#$ -cwd
#$ -j y
#$ -r y

export _JAVA_OPTIONS="-Xms256M -Xmx16384M -XX:ParallelGCThreads=1"
export PATH="/netapp/home/kirsty.jamieson/miniconda3/bin:$PATH"
LIB=/scrapp/kirsty.jamieson/atac-seq-pipeline

source activate encode-atac-seq-pipeline
INPUT=$LIB/examples/local/ENCSR356KRQ_subsampled.json
java -jar -Dconfig.file=$LIB/backends/backend.conf $LIB/cromwell-34.jar run atac.wdl -i ${INPUT}

leepc12 · 2018-11-28T00:05:54Z

Please attach a tar ball of all logs for debugging. When you created this issue, you should see an instruction to make a tar ball.

Is there a particular reason that two memory settings differ (mem_free=8G and -Xmx16384M)?

kirstyjamieson · 2018-11-28T00:13:04Z

No good reason, I'll remove -Xmx16384M in the future.

debug_[nodup_bam_#55].tar.gz

leepc12 · 2018-11-28T19:42:27Z

Your TAG-ALIGN looks trivially small.

PID=10830: -rw-r--r-- 1 kirsty.jamieson shen   51 Nov 27 15:31 KJ064_R1_TRIM.trim.nodup.tn5.tagAlign.gz
PID=10830: -rw-r--r-- 1 kirsty.jamieson shen 4060 Nov 27 15:15 script
PID=10830: -rw-r--r-- 1 kirsty.jamieson shen  405 Nov 27 15:15 script.background
PID=10830: -rw-r--r-- 1 kirsty.jamieson shen  163 Nov 27 15:15 script.submit
PID=10830: -rw-r--r-- 1 kirsty.jamieson shen    0 Nov 27 15:15 stderr
PID=10830: -rw-r--r-- 1 kirsty.jamieson shen    0 Nov 27 15:15 stderr.background
PID=10830: -rw-r--r-- 1 kirsty.jamieson shen 2102 Nov 27 15:31 stdout
PID=10830: -rw-r--r-- 1 kirsty.jamieson shen    5 Nov 27 15:15 stdout.background

Something is wrong with your BAM inputs?

kirstyjamieson · 2018-11-28T20:05:06Z

I don't think the bam file is the issue. It was generated from your previous pipeline and gave a reasonable-sized tag-align.

-rw-r--r-- 1 kirsty.jamieson shen 7026944483 Sep 22 12:51 KJ064_R1_TRIM.trim.bam
-rw-r--r-- 1 kirsty.jamieson shen 2793488 Sep 22 12:54 KJ064_R1_TRIM.trim.bam.bai
-rw-r--r-- 1 kirsty.jamieson shen 2319815474 Sep 22 11:37 KJ064_R1_TRIM.trim.fastq.gz
-rw-r--r-- 1 kirsty.jamieson shen 1504625562 Sep 22 13:49 KJ064_R1_TRIM.trim.nodup.bam
-rw-r--r-- 1 kirsty.jamieson shen 6809488 Sep 22 13:50 KJ064_R1_TRIM.trim.nodup.bam.bai
-rw-r--r-- 1 kirsty.jamieson shen 254422820 Sep 22 14:05 KJ064_R1_TRIM.trim.nodup.tagAlign.gz
-rw-r--r-- 1 kirsty.jamieson shen 237655009 Sep 22 14:10 KJ064_R1_TRIM.trim.nodup.tn5.no_chrM.25M.tagAlign.gz
-rw-r--r-- 1 kirsty.jamieson shen 254694043 Sep 22 14:07 KJ064_R1_TRIM.trim.nodup.tn5.tagAlign.gz

leepc12 · 2018-11-28T20:16:34Z

Can you upload an input JSON for that previous pipeline run (which starts from FASTQs)?
Is this sample paired end?

kirstyjamieson · 2018-11-28T20:26:33Z

I used the json you provided. Yes, it's paired end.

debug_[nodup_#55_sample_fastq].tar.gz

kirstyjamieson · 2018-11-28T22:16:10Z

Could you send me a json file that you used for a successful run starting from bam?

leepc12 · 2018-11-29T21:43:33Z

@kirstyjamieson: Here is an example input JSON file which starts from nodup_bams.

{
    "atac.pipeline_type" : "atac",
    "atac.genome_tsv" : "/mnt/data/pipeline_genome_data/hg38_chr19_chrM/hg38_chr19_chrM_klab.tsv",
    "atac.nodup_bams" : [
        "./cromwell-executions/atac/c33c7037-5873-4772-aef2-e748a27b6fd4/call-filter/shard-0/execution/ENCFF341MYG.subsampled.400.trim.merged.nodup.bam",
        "./cromwell-executions/atac/c33c7037-5873-4772-aef2-e748a27b6fd4/call-filter/shard-1/execution/ENCFF641SFZ.subsampled.400.trim.merged.nodup.bam"
    ],

    "atac.paired_end" : true,
    "atac.multimapping" : 4,

    "atac.auto_detect_adapter" : true,

    "atac.smooth_win" : 73,
    "atac.enable_idr" : true,
    "atac.idr_thresh" : 0.05,

    "atac.enable_xcor" : true,

    "atac.title" : "ENCSR356KRQ",
    "atac.description" : "ATAC-seq on primary keratinocytes in day 0.0 of differentiation"
}

I tested pipelines starting from FASTQs and NODUP_BAMs. Both worked fine. Got the same BED outputs (*.tagAlign.gz).

$ find -name *.tagAlign.gz | grep -v inputs | grep -v glob | xargs ls -l
-rw-r--r-- 2 leepc12 users 175596 Nov 29 13:02 ./cromwell-executions/atac/c33c7037-5873-4772-aef2-e748a27b6fd4/call-bam2ta/shard-0/execution/ENCFF341MYG.subsampled.400.trim.merged.nodup.tn5.tagAlign.gz
-rw-r--r-- 2 leepc12 users 225168 Nov 29 13:02 ./cromwell-executions/atac/c33c7037-5873-4772-aef2-e748a27b6fd4/call-bam2ta/shard-1/execution/ENCFF641SFZ.subsampled.400.trim.merged.nodup.tn5.tagAlign.gz
-rw-r--r-- 2 leepc12 users 175596 Nov 29 13:37 ./cromwell-executions/atac/e8d64aa0-6394-409c-a171-1d3e64d6dffa/call-bam2ta/shard-0/execution/ENCFF341MYG.subsampled.400.trim.merged.nodup.tn5.tagAlign.gz
-rw-r--r-- 2 leepc12 users 225168 Nov 29 13:37 ./cromwell-executions/atac/e8d64aa0-6394-409c-a171-1d3e64d6dffa/call-bam2ta/shard-1/execution/ENCFF641SFZ.subsampled.400.trim.merged.nodup.tn5.tagAlign.gz

kirstyjamieson · 2018-11-29T22:59:43Z

I took the nodup bams generated from the successful run when I started at your subsampled fastq and that worked. I get mixed results when I start with my own tag-align files. For one pair, it succeeded and for another pair it failed at the very end with:

"SingleWorkflowRunnerActor received Failure message: connection exception: closed java.sql.SQLNonTransientConnectionException: connection exception: closed."

I did manage to get idr peaks before it failed.

I also tried 3 replicates with tag-aligns and got a different failure, much earlier on:

"WorkflowManagerActor Workflow 72c2bf95-1c83-49e4-9e6f-e48151ac76bb failed (during ExecutingWorkflowState): cromwell.backend.standard.StandardAsyncExecutionActor$$anon$2: Failed to evaluate job outputs"

So the pipeline seems to work well with subsampled files but fails with my much larger files.

leepc12 · 2018-11-29T23:22:31Z

Let's stick to a single failure case (starting from your own large nodup_bam files).

You got this good-sized NODUP_BAM and TAG-ALIGN when you started a pipeline from FASTQ

-rw-r--r-- 1 kirsty.jamieson shen 1504625562 Sep 22 13:49 KJ064_R1_TRIM.trim.nodup.bam
-rw-r--r-- 1 kirsty.jamieson shen 254422820 Sep 22 14:05 KJ064_R1_TRIM.trim.nodup.tagAlign.gz

But you failed to get the same TAG-ALIGN when you started from NODUP_BAM.

Please upload your input JSON files for those two cases.

kirstyjamieson · 2018-11-29T23:39:05Z

Those files were generated with the previous pipeline.

leepc12 · 2018-11-30T21:35:42Z

I have processed >100 large samples from ENCODE and they all worked fine.
It looks like bam2ta task failed due to resource limit.

Please increase memory in your job submission shell script first.

#$ -l mem_free=24G

Also remove all resource settings from your input JSON file. Those resources are too small for your large samples.

"atac.trim_adapter.cpu" : 1,
"atac.trim_adapter.mem_mb" : 4000,
"atac.trim_adapter.time_hr" : 1,
"atac.bowtie2_cpu" : 1,
"atac.bowtie2_mem_mb" : 4000,
"atac.bowtie2_time_hr" : 1,
"atac.filter_cpu" : 1,
"atac.filter_mem_mb" : 4000,
"atac.filter_time_hr" : 1,
"atac.macs2_mem_mb" : 4000,
"atac.macs2_time_hr" : 1,
"atac.ataqc.mem_mb" : 4000,
"atac.ataqc.time_hr" : 1

Next time please use a template examples/template_pe.json (https://github.com/ENCODE-DCC/atac-seq-pipeline/blob/master/examples/template_pe.json). This template has all default parameters.

kirstyjamieson · 2018-12-05T00:16:12Z

I tried increasing memory and used the default parameters from the template. I am still getting mixed results.

leepc12 · 2018-12-05T01:44:33Z

@kirstyjamieson: Please pick one failed sample and upload an error log, tar ball and input JSON for it.

kirstyjamieson · 2018-12-05T18:19:59Z

run_induced_nodupbam.sh.txt
run_induced_nodupbam.sh.o525095.txt
debug_[#59_12_5_18].tar.gz

induced_nodupbam.json

{
    "atac.nodup_bams" : [
        "test_sample/induced/rep1/KJ064_R1_TRIM.trim.nodup.bam",
        "test_sample/induced/rep2/KJ065_R1_TRIM.trim.nodup.bam",
	"test_sample/induced/rep3/KJ066_R1_TRIM.trim.nodup.bam"
    ],

    "atac.title" : "Induced RPEs",
    "atac.description" : "3 replicates for induced RPEs starting from nodup bam.",

    "atac.pipeline_type" : "atac",
    "atac.genome_tsv" : "genome/hg38/hg38.tsv",
    "atac.paired_end" : true,

    "atac.align_only" : false,
    "atac.true_rep_only" : false,

    "atac.cutadapt_min_trim_len" : 5,
    "atac.cutadapt_err_rate" : 0.1,

    "atac.multimapping" : 0,

    "atac.bowtie2_score_min" : "",

    "atac.dup_marker" : "picard",
    "atac.mapq_thresh" : 30,
    "atac.no_dup_removal" : false,

    "atac.regex_filter_reads" : "chrM",
    "atac.subsample_reads" : 0,

    "atac.enable_xcor" : false,
    "atac.xcor_subsample_reads" : 25000000,

    "atac.keep_irregular_chr_in_bfilt_peak" : false,        

    "atac.cap_num_peak" : 300000,
    "atac.pval_thresh" : 0.01,
    "atac.smooth_win" : 150,

    "atac.enable_idr" : true,
    "atac.idr_thresh" : 0.1,

    "atac.disable_ataqc" : false,

    "atac.trim_adapter_cpu" : 2,
    "atac.trim_adapter_mem_mb" : 12000,
    "atac.trim_adapter_time_hr" : 24,
    "atac.trim_adapter_disks" : "local-disk 100 HDD",

    "atac.bowtie2_cpu" : 4,
    "atac.bowtie2_mem_mb" : 20000,
    "atac.bowtie2_time_hr" : 48,
    "atac.bowtie2_disks" : "local-disk 100 HDD",

    "atac.filter_cpu" : 2,
    "atac.filter_mem_mb" : 20000,
    "atac.filter_time_hr" : 24,
    "atac.filter_disks" : "local-disk 100 HDD",

    "atac.bam2ta_cpu" : 2,
    "atac.bam2ta_mem_mb" : 10000,
    "atac.bam2ta_time_hr" : 6,
    "atac.bam2ta_disks" : "local-disk 100 HDD",

    "atac.spr_mem_mb" : 16000,

    "atac.xcor_cpu" : 2,
    "atac.xcor_mem_mb" : 16000,
    "atac.xcor_time_hr" : 6,
    "atac.xcor_disks" : "local-disk 100 HDD",

    "atac.macs2_mem_mb" : 16000,
    "atac.macs2_time_hr" : 24,
    "atac.macs2_disks" : "local-disk 100 HDD",

    "atac.ataqc_mem_mb" : 16000,
    "atac.ataqc_mem_java_mb" : 16000,
    "atac.ataqc_time_hr" : 24,
    "atac.ataqc_disks" : "local-disk 100 HDD"
}

leepc12 · 2018-12-05T20:59:08Z

Pipeline failed to convert your BAMs into BEDs.

Let's do some line-by-line debugging.

YOUR_WORK_DIR=~/temp_dir

mkdir -p $YOUR_WORK_DIR && cd $YOUR_WORK_DIR

source activate encode-atac-seq-pipeline

sambamba sort -n /scrapp/kirsty.jamieson/atac-seq-pipeline/cromwell-executions/atac/6155fd91-835b-4644-b8d5-c4a8642a3263/call-bam2ta/shard-0/inputs/-1239304996/KJ064_R1_TRIM.trim.nodup.bam -o KJ064_R1_TRIM.trim.nodup.nmsrt.bam -t 2

LC_COLLATE=C bedtools bamtobed -bedpe -mate1 -i KJ064_R1_TRIM.trim.nodup.nmsrt.bam | gzip -nc > KJ064_R1_TRIM.trim.nodup.bedpe.gz

zcat -f KJ064_R1_TRIM.trim.nodup.bedpe.gz | awk 'BEGIN{OFS="\t"}{printf "%s\t%s\t%s\tN\t1000\t%s\n%s\t%s\t%s\tN\t1000\t%s\n",$1,$2,$3,$9,$4,$5,$6,$10}' | grep -P -v 'chrM' | gzip -nc > KJ064_R1_TRIM.trim.nodup.tagAlign.gz

zcat -f KJ064_R1_TRIM.trim.nodup.tagAlign.gz | awk 'BEGIN {OFS = "\t"}{ if ($6 == "+") {$2 = $2 + 4} else if ($6 == "-") {$3 = $3 - 5} print $0}' | gzip -nc > KJ064_R1_TRIM.trim.nodup.tn5.tagAlign.gz

ls -l

Can you also share your BAM files (test_sample/induced/rep1/KJ064_R1_TRIM.trim.nodup.bam, ...) with me via Dropbox (leepc12 at gmail dot com) or Google Drive (leepc12 at gmail dot com)? I would like to replicate this error on my computer.

kirstyjamieson · 2018-12-05T21:54:25Z

Yeah, I can't get to the beds. I shared the files on google drive.

#!/bin/bash
#$ -l arch=linux-x64
#$ -l h_rt=48:0:0
#$ -l mem_free=24G
#$ -S /bin/bash
#$ -cwd
#$ -j y
#$ -r y

export TMPDIR="/scrapp/kirsty.jamieson/tmp/"
export PATH="/netapp/home/kirsty.jamieson/miniconda3/bin:$PATH"
LIB=/scrapp/kirsty.jamieson/atac-seq-pipeline

source activate encode-atac-seq-pipeline

sambamba sort -n /scrapp/kirsty.jamieson/atac-seq-pipeline/cromwell-executions/atac/6155fd91-835b-4644-b8d5-c4a8642a3263/call-bam2ta/shard-0/inputs/-1239304996/KJ064_R1_TRIM.trim.nodup.bam -o KJ064_R1_TRIM.trim.nodup.nmsrt.bam -t 2

LC_COLLATE=C bedtools bamtobed -bedpe -mate1 -i KJ064_R1_TRIM.trim.nodup.nmsrt.bam | gzip -nc > KJ064_R1_TRIM.trim.nodup.bedpe.gz

zcat -f KJ064_R1_TRIM.trim.nodup.bedpe.gz | awk 'BEGIN{OFS="\t"}{printf "%s\t%s\t%s\tN\t1000\t%s\n%s\t%s\t%s\tN\t1000\t%s\n",$1,$2,$3,$9,$4,$5,$6,$10}' | grep -P -v 'chrM' | gzip -nc > KJ064_R1_TRIM.trim.nodup.tagAlign.gz

zcat -f KJ064_R1_TRIM.trim.nodup.tagAlign.gz | awk 'BEGIN {OFS = "\t"}{ if ($6 == "+") {$2 = $2 + 4} else if ($6 == "-") {$3 = $3 - 5} print $0}' | gzip -nc > KJ064_R1_TRIM.trim.nodup.tn5.tagAlign.gz

ls -l

Output

-rw-r--r-- 1 kirsty.jamieson shen       1103 Dec  5 13:07 debug.sh
-rw-r--r-- 1 kirsty.jamieson shen         89 Dec  5 13:10 debug.sh.o525406
-rw-r--r-- 1 kirsty.jamieson shen         86 Dec  5 13:28 KJ064_R1_TRIM.trim.nodup.bedpe.gz
-rw-r--r-- 1 kirsty.jamieson shen 1719191526 Dec  5 13:24 KJ064_R1_TRIM.trim.nodup.nmsrt.bam
-rw-r--r-- 1 kirsty.jamieson shen         51 Dec  5 13:28 KJ064_R1_TRIM.trim.nodup.tagAlign.gz
-rw-r--r-- 1 kirsty.jamieson shen         51 Dec  5 13:28 KJ064_R1_TRIM.trim.nodup.tn5.tagAlign.gz

leepc12 · 2018-12-05T23:28:53Z

I replicated this error. It turns out that your BAM file does not have any paired-ended reads.

(encode-atac-seq-pipeline) leepc12@kadru:/srv/scratch/leepc12/debug_atac_59_4_run$ ll
total 3148308
drwxr-xr-x  2 leepc12 users       4096 Dec  5 15:23 ./
drwxr-xr-x 67 leepc12 users      20480 Dec  5 14:54 ../
-rw-r--r--  1 leepc12 users 1504625562 Dec  5 14:59 KJ064_R1_TRIM.trim.nodup.bam
-rw-r--r--  1 leepc12 users         86 Dec  5 15:23 KJ064_R1_TRIM.trim.nodup.bedpe.gz
-rw-r--r--  1 leepc12 users 1719191526 Dec  5 15:21 KJ064_R1_TRIM.trim.nodup.nmsrt.bam
-rw-r--r--  1 leepc12 users         51 Dec  5 15:23 KJ064_R1_TRIM.trim.nodup.tagAlign.gz
-rw-r--r--  1 leepc12 users         51 Dec  5 15:23 KJ064_R1_TRIM.trim.nodup.tn5.tagAlign.gz
(encode-atac-seq-pipeline) leepc12@kadru:/srv/scratch/leepc12/debug_atac_59_4_run$ samtools view KJ064_R1_TRIM.trim.nodup.nmsrt.bam | head
A00351:44:H5W3YDSXX:1:1101:10004:13651  0       chr15   34808208        255     51M     *       0       0       CAGTGAGGCAGTATGAGTCAGCACTCCCTTTTTGCCAGGATGGTGTCAGGA FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF     MD:Z:51 PG:Z:MarkDuplicates     XG:i:0  NM:i:0  XM:i:0  XN:i:0  XO:i:0  AS:i:102    YT:Z:UU
A00351:44:H5W3YDSXX:1:1101:10004:15154  0       chr14   68816824        255     51M     *       0       0       CCTCGGAGGCAGCACGATGGACGTGGCCACACTGCCCTCCAGTGGCCAGCT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF     MD:Z:51 PG:Z:MarkDuplicates     XG:i:0  NM:i:0  XM:i:0  XN:i:0  XO:i:0  AS:i:102    YT:Z:UU
A00351:44:H5W3YDSXX:1:1101:10004:15812  0       chr2    34664477        255     35M     *       0       0       TTCTTTCGGAGAAACAAGCCAAGCCTCCCTACAGCFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF      MD:Z:35 PG:Z:MarkDuplicates     XG:i:0  NM:i:0  XM:i:0  XN:i:0  XO:i:0  AS:i:70 YT:Z:UU
A00351:44:H5W3YDSXX:1:1101:10004:19194  0       chr7    83446287        255     44M     *       0       0       GTATATAGGCTCATCTGAATAACAGTGAAGGCATCTTACAATTG        FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF    MD:Z:44 PG:Z:MarkDuplicates     XG:i:0  NM:i:0  XM:i:0  XN:i:0  XO:i:0  AS:i:88 YT:Z:UU
A00351:44:H5W3YDSXX:1:1101:10004:19695  16      chr5    112146436       40      51M     *       0       0       AGGAGCAGAGGATCTTCCAACGCTGTTTGCGCTCCCCAAAGACTCTTGCAC FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF     MD:Z:51 PG:Z:MarkDuplicates     XG:i:0  NM:i:0  XM:i:0  XN:i:0  XO:i:0  AS:i:102    XS:i:40 YT:Z:UU
A00351:44:H5W3YDSXX:1:1101:10004:23109  16      chr3    57692747        40      51M     *       0       0       GAGGAGCGCCGAGAAAGGGCGGGGCCGGGCCTCACCTCCACGGCCTGGCCC ,FFFF:FFFFFFFFFFFFFFFFFFFFFFFFFFFF:FFFFF:F:FFFFFFF:     MD:Z:51 PG:Z:MarkDuplicates     XG:i:0  NM:i:0  XM:i:0  XN:i:0  XO:i:0  AS:i:102    XS:i:42 YT:Z:UU
A00351:44:H5W3YDSXX:1:1101:10004:23766  0       chr19   39098460        255     51M     *       0       0       GAGCCAGGCTCCATGACTGTAACTTGGACCACATGGGTCCCAACCCGCTCT FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF     MD:Z:51 PG:Z:MarkDuplicates     XG:i:0  NM:i:0  XM:i:0  XN:i:0  XO:i:0  AS:i:102    YT:Z:UU
A00351:44:H5W3YDSXX:1:1101:10004:24111  0       chr11   45286298        40      51M     *       0       0       AGCCAGCAGCTCTCCCGCCGCCAGAGGGGCGGGGACGGAGGGAGGGAGGAC FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF     MD:Z:51 PG:Z:MarkDuplicates     XG:i:0  NM:i:0  XM:i:0  XN:i:0  XO:i:0  AS:i:102    XS:i:40 YT:Z:UU
A00351:44:H5W3YDSXX:1:1101:10004:26553  16      chr9    133371276       255     51M     *       0       0       CACATCCTAGAAACAAGCACCTGCGGCCCAGCGGCTTCCCTCACATCAGCC FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF     MD:Z:51 PG:Z:MarkDuplicates     XG:i:0  NM:i:0  XM:i:0  XN:i:0  XO:i:0  AS:i:102    YT:Z:UU
A00351:44:H5W3YDSXX:1:1101:10004:28526  0       chr7    70866137        255     48M     *       0       0       CTACAGCTTCATCCTTTGAGACCTGGAGTGCCAGGACACCCAGGCTCC    FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF        MD:Z:48 PG:Z:MarkDuplicates     XG:i:0  NM:i:0  XM:i:0  XN:i:0  XO:i:0  AS:i:96     YT:Z:UU
(encode-atac-seq-pipeline) leepc12@kadru:/srv/scratch/leepc12/debug_atac_59_4_run$ samtools view -c -f 1 KJ064_R1_TRIM.trim.nodup.nmsrt.bam | head
0

Please try with single-ended settings.

{
    ...
   "atac.paired_end" : false,
    ...
}

kirstyjamieson · 2018-12-07T16:58:51Z

Yes, you are right! I had a typo in my script from the original pipeline where I generated the bam, so it only recognized the first read of the pair. Thank you for your help!

leepc12 closed this as completed Dec 7, 2018

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

nodup bam #59

nodup bam #59

kirstyjamieson commented Nov 27, 2018

leepc12 commented Nov 27, 2018

kirstyjamieson commented Nov 27, 2018

leepc12 commented Nov 27, 2018

kirstyjamieson commented Nov 27, 2018

leepc12 commented Nov 27, 2018

kirstyjamieson commented Nov 27, 2018

leepc12 commented Nov 28, 2018

kirstyjamieson commented Nov 28, 2018

leepc12 commented Nov 28, 2018

kirstyjamieson commented Nov 28, 2018

leepc12 commented Nov 28, 2018

kirstyjamieson commented Nov 28, 2018

kirstyjamieson commented Nov 28, 2018

leepc12 commented Nov 29, 2018 •

edited

Loading

kirstyjamieson commented Nov 29, 2018

leepc12 commented Nov 29, 2018

kirstyjamieson commented Nov 29, 2018

leepc12 commented Nov 30, 2018

kirstyjamieson commented Dec 5, 2018

leepc12 commented Dec 5, 2018 •

edited

Loading

kirstyjamieson commented Dec 5, 2018

leepc12 commented Dec 5, 2018

kirstyjamieson commented Dec 5, 2018

leepc12 commented Dec 5, 2018

kirstyjamieson commented Dec 7, 2018

nodup bam #59

nodup bam #59

Comments

kirstyjamieson commented Nov 27, 2018

leepc12 commented Nov 27, 2018

kirstyjamieson commented Nov 27, 2018

leepc12 commented Nov 27, 2018

kirstyjamieson commented Nov 27, 2018

leepc12 commented Nov 27, 2018

kirstyjamieson commented Nov 27, 2018

leepc12 commented Nov 28, 2018

kirstyjamieson commented Nov 28, 2018

leepc12 commented Nov 28, 2018

kirstyjamieson commented Nov 28, 2018

leepc12 commented Nov 28, 2018

kirstyjamieson commented Nov 28, 2018

kirstyjamieson commented Nov 28, 2018

leepc12 commented Nov 29, 2018 • edited Loading

kirstyjamieson commented Nov 29, 2018

leepc12 commented Nov 29, 2018

kirstyjamieson commented Nov 29, 2018

leepc12 commented Nov 30, 2018

kirstyjamieson commented Dec 5, 2018

leepc12 commented Dec 5, 2018 • edited Loading

kirstyjamieson commented Dec 5, 2018

leepc12 commented Dec 5, 2018

kirstyjamieson commented Dec 5, 2018

leepc12 commented Dec 5, 2018

kirstyjamieson commented Dec 7, 2018

leepc12 commented Nov 29, 2018 •

edited

Loading

leepc12 commented Dec 5, 2018 •

edited

Loading