DNA-inspired structs and functions in Rust, mostly for the author's practice.
See Cargo.toml
. This shouldn't be much of a concern when using Cargo, anyway.
At the moment, a nightly build is needed (for try_from). You can switch with rustup
.
With a "-i" flag, the executable will take a string of elements in "ACGT" and print out the protein sequence that the DNA codes for.
For instance:
cargo run -- -i CCATGTCGAAGTCGCTAAGCTCTCGTAGAAAATCGATTAGATAAATATATATATGCTGCTCGAGATCGA
MSKSLSSRRKSIR
MLLEI
If no flag option is passed, the executable will try to open the file(s) with the given name for reading.
cargo run gene.fna
fix file reading process to deal with standard (and possibly large) FASTA files intelligently
function to copy/mutate a BaseSeq with configurable insertion, deletion, and SNP rates.
sexual reproduction with crossover
comparison functions of sequences (e.g. total base numbers, "strength" (GC minus AT) or other combinations). can do di/tri-nucleotide frequency and correlation functions as well. this could help form metrics for sequence comparison.