Version 1.5.1, Nov 2023
Author: Kun Sun (sunkun@szbl.ac.cn)
Distributed under the
GNU General Public License v3.0 (GPLv3)
for personal and academic usage only.
For detailed information please refer to the license files under license
directory.
The author is pleased to release version 1.5 of Ktrim with two features to improve its usability: it allows the users to use a file to record the paths to the FASTQ files (e.g., the library was sequenced multiple times), and output to stdout to pipe with other software (e.g., aligners).
- Fast, sensitive, and accurate
- Supports both paired- and single-end data
- Supports both Gzipped and plain text
- Supports multi-threading for speed-up
- Built-in support for common adapters; customized adapters are also supported
Ktrim
is written in C++
for GNU Linux/Unix platforms. After uncompressing the source package, you
can find an executable file ktrim
under bin/
directory compiled using g++ v4.8.5
and linked with
libz v1.2.7
for Linux x86_64 system. If you could not run it (which is usually caused by low version of
libc++
or libz
library) or you want to build a version optimized for your system, you can re-compile
the programs:
user@linux$ make clean && make
The main program is ktrim
under bin/
directory. You can add its path to your ~/.bashrc
file under
the PATH
variable to call it from anywhere; or you can run the following command to add it to your
current session:
user@linux$ PATH=$PATH:$PWD/bin/
You can also add ktrim
to your system to call it from anywhere and share with other users (requires
root privilege):
user@linux# make install
Call ktrim
without any parameters to see the usage (or use '-h' option):
Usage: Ktrim [options] -f fq.list {-1/-U Read1.fq [-2 Read2.fq ]} -o out.prefix
Author : Kun Sun (sunkun@szbl.ac.cn)
Version: 1.5.0 (May 2023)
Ktrim is designed to perform adapter- and quality-trimming of FASTQ files.
Compulsory parameters:
-f fq.list Specify the path to a file containing path to read 1/2 fastq files
OR you can specify the fastq files directly:
-1/-U Read1.fq Specify the path to the files containing read 1
If your data is Paired-end, use '-1' and specify read 2 files using '-2' option
Note that if '-U' is used, specification of '-2' is invalid
If you have multiple files for your sample, use ',' to separate them
Note that Gzip-compressed files (with .gz suffix) are also supported
-o out.prefix Specify the prefix of the output files
Note that output files include trimmed reads in FASTQ format and statistics
Optional parameters:
-2 Read2.fq Specify the path to the file containing read 2
Use this parameter if your data is generated in paired-end mode
If you have multiple files for your sample, use ',' to separate them
and make sure that all the files are well paired in '-1' and '-2' options
-c Write the trimming results to stdout (default: not set)
Note that the interleaved fastq format will be used for paired-end data.
-t threads Specify how many threads should be used (default: 4)
You can set '-t' to 0 to use all threads (automatically detected)
2-8 threads are recommended, as more threads would not benefit the performance
-p phred-base Specify the baseline of the phred score (default: 33)
-q score The minimum quality score to keep the cycle (default: 20)
Note that 20 means 1% error rate, 30 means 0.1% error rate in Phred
-w window Set the window size for quality check (default: 5)
Ktrim will stop when all the bases in a consecutive window pass the quality threshold
Phred 33 ('!') and Phred 64 ('@') are the most widely used scoring system
while quality scores start from 35 ('#') in the FASTQ files is also common
-s size Minimum read size to be kept after trimming (default: 36)
-k kit Specify the sequencing kit to use built-in adapters
Currently supports 'Illumina' (default), 'Nextera', 'Transposase' and 'BGI'
-a sequence Specify the adapter sequence in read 1
-b sequence Specify the adapter sequence in read 2
If '-a' is set while '-b' is not, I will assume that read 1 and 2 use same adapter
Note that '-k' option has a higher priority (when set, '-a'/'-b' will be ignored)
-m proportion Set the proportion of mismatches allowed during index and sequence comparison
Default: 0.125 (i.e., 1/8 of compared base pairs)
-h Show this help information and quit
-v Show the software version and quit
Please refer to README.md file for more information (e.g., setting adapters).
Ktrim: extra-fast and accurate adapter- and quality-trimmer.
Please note that from version 1.2.0, Ktrim supports Gzip-compressed files as input. If you have multiple lanes of FASTQ files, Ktrim even supports that some lanes are compressed while others are in plain text, as long as READ1 and READ2 are the same (either both compressed or plain text) for each lane of paired-end data.
Ktrim
contains built-in adapter sequences used by Illumina TruSeq kits, Nextera kits, Nextera transposase
adapters and BGI sequencing kits within the package. However, customized adapter sequences are also allowed
by setting '-a' (for read 1) and '-b' (for read 2; if it is the same as read 1, you can left it blank)
options. You may need to refer to the manual of your library preparation kit for the adapter sequences.
Note that in the current version of Ktrim
, only 1 pair of adapters is allowed.
Here are the built-in adapter sequences (the copyright should belong to the corresponding companies):
Illumina TruSeq kits:
AGATCGGAAGAGC (for both read 1 and read 2)
Nextera kits (suitable for ATAC-seq, Cut & tag data):
CTGTCTCTTATACACATCT (for both read 1 and read 2)
BGI adapters:
Read 1: AAGTCGGAGGCCAAGCGGTC
Read 2: AAGTCGGATCGTAGCCATGT
Your data is generated using Illumina TruSeq kit in Single-end mode, then you can run:
user@linux$ ktrim -U /path/to/read1.fq -o /path/to/output/dir
Your data is generated using a kit with customized adapters; your data is composed of 3 lanes in Paired-end
mode and you have prepared a file.list
to record the paths as follows:
/path/to/lane1.read1.fq.gz /path/to/lane1.read2.fq.gz
/path/to/lane2.read1.fq.gz /path/to/lane2.read2.fq.gz
/path/to/lane3.read1.fq /path/to/lane3.read2.fq
in addition, your Phred scoring system starts from 64; you want to keep the high quality (Phred score >=30) bases and reads longer than 50 bp after trimming; and you want to use 8 threads to speed-up the analysis, then you can run:
user@linux$ ktrim -f file.list -t 8 -p 64 -q 30 -s 50 -o /path/to/output/dir \
-a READ1_ADAPTER_SEQUENCE -b READ2_ADAPTER_SEQUENCE
Ktrim
outputs the trimmed reads in FASTQ format and key statistics (e.g., the numbers of reads that
contains adapters and the number of reads in the trimmed files).
Under the testing_dataset/
directory, a script named simu.reads.pl
is provided to generate in silico
reads for testing purpose only. Note that the results in the paper is based on the data generated by this
script. Another script check.accuracy.pl
is designed to evaluate the accuracies of the trimming tools.
Please refer to Supplementary Method in the paper for reproducing the results (using Ktrim v1.1.0).
When referencing, please cite "Sun K: Ktrim: an extra-fast and accurate adapter- and quality-trimmer for sequencing data. Bioinformatics 2020 Jun 1; 36(11):3561-3562." PubMed Full Text
Please send bug reports to Kun Sun (sunkun@szbl.ac.cn).
Ktrim is freely available at
https://github.com/hellosunking/Ktrim/.