Something odd with sites object in unit test for forward bidir search

[iqbal-lab]

In test Long_site_and_repeated_snp_on_edge_of_site at commit 2a41ce1

We have
prg = gacatagacacacagt5gtcgcctcgtcggctttgagt6gtcgctgctccacacagagact5ggtgctagac7c8a7ccagctgctccacacagaga
and

  //read aligns across sites 5 and 7, allele 1 in both cases                                                                                                              
    query="tagacacacagtgtcgcctcgtcggctttgagtggtgctagacccca";

First the unit test does a bidir backward search and all the unti test assertions pass

` EXPECT_EQ(true,first_del);
EXPECT_EQ(1,sa_intervals.size());
EXPECT_EQ(no_occ,1);

EXPECT_EQ(sites.front().front().first, 7);
EXPECT_EQ(sites.front().front().second.front(), 1);
EXPECT_EQ(sites.front().front().second.size(), 1);
EXPECT_EQ(sites.front().back().first, 5);
EXPECT_EQ(sites.front().back().second.front(), 1);
EXPECT_EQ(sites.front().back().second.size(), 1);`

If we print the sites variable we see this

p sites
$1 = std::list = {[0] = std::vector of length 2, capacity 100 = {{first = 7, second= std::vector of length 1, capacity 1 = {1}}, {first = 5, second = std::vector of length 1, capacity 1 = {1}}}} 

Then we clear variables:

sa_intervals.clear(); sa_intervals_rev.clear(); sites.clear();

and search with the bidir forwards search. Now as soon as we finish the forward search, we print sites and see this:

p sites $3 = std::list = {[0] = std::vector of length 4, capacity 4 = {{first = 5, second =std::vector of length 3, capacity 3 = {1, 2, 1}}, {first = 5, second = std::vector of length 4, capacity 4 = {1, 2, 1, 2}}, {first = 7, second = std::vector of length 4, capacity 4 = {1, 2, 1, 2}}, {first = 7, second = std::vector of length 5, capacity 5 = {1, 2, 1, 2, 1}}}}

That doesnt look right to me at all, and when we get to the assertions we have this code

EXPECT_EQ(sites.front().front().first, 5); EXPECT_EQ(sites.front().front().second.front(), 1); EXPECT_EQ(sites.front().front().second.size(), 1); EXPECT_EQ(sites.front().back().first, 7); EXPECT_EQ(sites.front().back().second.front(), 1); EXPECT_EQ(sites.front().back().second.size(), 1);

and this output
`./test/unittest_bidir_search_bwd_fwd.cpp:586: Failure
Value of: 1
Expected: sites.front().front().second.size()
Which is: 3

./test/unittest_bidir_search_bwd_fwd.cpp:589: Failure
Value of: 1
Expected: sites.front().back().second.size()
Which is: 5
`

[iqbal-lab]

So looks like in the forward search we are not adding to sites object properly.

[iqbal-lab]

In commit 318a43b I've added a similar check in an earlier unit test (2SNPs) and that also fails:

[ RUN ] BackwardSearchTest.TwoSNPs
./test/unittest_bidir_search_bwd_fwd.cpp:229: Failure
Value of: 1
Expected: sites.front().back().second.size()
Which is: 3
[ FAILED ] BackwardSearchTest.TwoSNPs (476 ms)

[iqbal-lab]

I notice we clear empty_allele differently in fwd and bwd

[ffranr]

No longer relevant.