Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

--info-file results in 'LinkedMatch' object has no attribute 'get_info_record' #431

Closed
Citteny opened this issue Dec 22, 2019 · 3 comments
Closed

Comments

@Citteny
Copy link

@Citteny Citteny commented Dec 22, 2019

Hi continuing #430
The goal is to get the trimmed sequence

I'm using linked adapters, and encountered a problem using the info file option.
i'm using cutadapt 2.7 (pip installation), Python 3.6.0

The command:
cutadapt -a "XNNNCAATAGCATGCCTTGCCGATTTGTCATC...AGATGGGGGGAAACAAANNNNX" --info-file info.txt merged_fq.fastq

Content of merged_fq.fastq:

@A00197:84:HHGW7DMXX:1:1102:28501:3505 1:N:0:TTACCGAC+CCTATCCT
ACACAATAGCATGCCTTGCCGATTTGTCATCTTTTCCAGTTCTTTAGTATCATGATTTATAGCATCCATATGTTCTTTTTCCATATTTTTCCAGCGCTCCATACTCTTCTGAAGCTCCTTAATTCCAGCTTCTGTTTTATCAATGGAATTGTCCAAATCTAAGATGGGGGGAAACAAAATTG
+
FFFFFFFFFFFFFFFFFFFFF:,:FFFFFFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJHJJJJJJJJJJJJHJJJJJJJJJJJJJJJJJJJJJJJJJJJJ@JJJJHJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

Traceback:

This is cutadapt 2.7 with Python 3.6.0
Command line parameters: -a XNNNCAATAGCATGCCTTGCCGATTTGTCATC...AGATGGGGGGAAACAAANNNNX --info-file info.txt merged_fq.fastq
Processing reads on 1 core in single-end mode ...
Traceback (most recent call last):
  File "/usr/.venvs/lsl/bin/cutadapt", line 8, in <module>
    sys.exit(main())
  File "/usr/.venvs/lsl/lib/python3.6/site-packages/cutadapt/__main__.py", line 825, in main
    stats = runner.run()
  File "/usr/.venvs/lsl/lib/python3.6/site-packages/cutadapt/pipeline.py", line 758, in run
    (n, total1_bp, total2_bp) = self._pipeline.process_reads(progress=self._progress)
  File "/usr/.venvs/lsl/lib/python3.6/site-packages/cutadapt/pipeline.py", line 266, in process_reads
    if filter_(read, matches):
  File "/usr/.venvs/lsl/lib/python3.6/site-packages/cutadapt/filters.py", line 91, in __call__
    if self.filter(read, matches):
  File "/usr/.venvs/lsl/lib/python3.6/site-packages/cutadapt/filters.py", line 409, in __call__
    info_record = match.get_info_record()
AttributeError: 'LinkedMatch' object has no attribute 'get_info_record'

Changed my path to "usr" for simplification.
Trimming is working fine without "--info-file " option.

Thank you

@Citteny Citteny changed the title --info-file results in LinkedMatch' object has no attribute 'get_info_record' --info-file results in 'LinkedMatch' object has no attribute 'get_info_record' Dec 22, 2019
@marcelm

This comment has been minimized.

Copy link
Owner

@marcelm marcelm commented Dec 23, 2019

Yes, this is similar to #430. I’ll look into this as soon as I have time.

@marcelm marcelm closed this in 190b658 Jan 8, 2020
@marcelm

This comment has been minimized.

Copy link
Owner

@marcelm marcelm commented Jan 8, 2020

This is now also fixed: Linked adapters will now be shown in the info file (one row for each of the two parts). Again, thanks for reporting!

@Citteny

This comment has been minimized.

Copy link
Author

@Citteny Citteny commented Jan 8, 2020

OMG, Thank you so much!
This tools is amazing!

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Projects
None yet
2 participants
You can’t perform that action at this time.