Permalink
Branch: master
Find file Copy path
Fetching contributors…
Cannot retrieve contributors at this time
44 lines (29 sloc) 1.08 KB

RNA-pdb-tools

You need to install rna-pdb-tools (http://rna-pdb-tools.readthedocs.io/en/latest/) first.

Draw VARNA-based image of RNA secondary structure

Type:

<pre>[ss:rna]
UUUCUGUAUAAUGCCGAUAAUAAGGUUCGGCAGUUUCUACCAAACAGCCGUAAACUGUUUGACUACAGUAA
((.(((((...((((((.........))))))........(((((((.......)))))))..))))).))
</pre>

Warning

Keep exactly the same syntax as in the example above and below.

The syntax:

<pre>
[ss:/name of your seq/]
/seq/
/ss/
</pre>
# ^ not <pre/> nor <pre>. Keep a new line after this syntax. So don't do:
</pre>
<pre>

but

</pre>

<pre>
# ^ this could be fixed at some point

Warning

This plugin will change your Markdown file, so make sure that your editor will detect this change and ask you to reload the file!

.. automodule:: engine.plugins.draw_secondary_structure
   :members:

to get a VARNA-drawn image of secondary structure.

../imgs/XQxIC1CrCP.gif