-
-
Notifications
You must be signed in to change notification settings - Fork 2
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
- Loading branch information
Showing
7 changed files
with
239 additions
and
0 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,8 @@ | ||
{ | ||
"project_name": "Wookie", | ||
"project_description": "Assemble wookie's genome", | ||
"show_files": [ | ||
"app.go", | ||
"app.yaml" | ||
] | ||
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,36 @@ | ||
package wookieapp | ||
|
||
import ( | ||
"encoding/json" | ||
"fmt" | ||
"net/http" | ||
"strings" | ||
|
||
"github.com/moul/wookie" | ||
) | ||
|
||
func init() { | ||
http.HandleFunc("/", handler) | ||
} | ||
|
||
type ResolveRequest struct { | ||
Sequences string `json:"Sequences,omitempty"` | ||
Options map[string]bool `json:"Options,omitempty"` | ||
} | ||
|
||
func handler(w http.ResponseWriter, r *http.Request) { | ||
decoder := json.NewDecoder(r.Body) | ||
var resolveRequest ResolveRequest | ||
err := decoder.Decode(&resolveRequest) | ||
|
||
if err != nil { | ||
fmt.Fprintf(w, "POST parsing error: %v\n", err) | ||
return | ||
} | ||
sequences := strings.Split(strings.TrimSpace(string(resolveRequest.Sequences)), "\n") | ||
wook := wookie.NewWookie(sequences) | ||
wook.Compute() | ||
output := wook.Genome.String() | ||
|
||
fmt.Fprintf(w, "%v\n", output) | ||
} |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,14 @@ | ||
application: wookie | ||
version: 1 | ||
runtime: go | ||
api_version: go1 | ||
|
||
handlers: | ||
- url: / | ||
static_files: static/index.html | ||
upload: static/index.html | ||
- url: /favicon\.ico | ||
static_files: static/favicon.ico | ||
upload: static/favicon.ico | ||
- url: /resolve | ||
script: _go_app |
Binary file not shown.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,173 @@ | ||
<!doctype html> | ||
<html> | ||
<head> | ||
<title>Wookie</title> | ||
<meta charset="utf-8"> | ||
<meta http-equiv="X-UA-Compatible" content="IE=edge"> | ||
<meta name="viewport" content="width=device-width, initial-scale=1"> | ||
|
||
<script src="//ajax.googleapis.com/ajax/libs/angularjs/1.4.3/angular.js"></script> | ||
<script src="//ajax.googleapis.com/ajax/libs/angularjs/1.4.3/angular-animate.js"></script> | ||
<script src="//angular-ui.github.io/bootstrap/ui-bootstrap-tpls-0.13.3.js"></script> | ||
<script src="//cdnjs.cloudflare.com/ajax/libs/angular-ui-bootstrap/0.13.3/ui-bootstrap.min.js"></script> | ||
<script src="//cdnjs.cloudflare.com/ajax/libs/ace/1.2.0/ace.min.js"></script> | ||
<script src="//cdnjs.cloudflare.com/ajax/libs/ace/1.2.0/theme-cobalt.js"></script> | ||
<script src="//cdnjs.cloudflare.com/ajax/libs/ace/1.2.0/worker-javascript.js"></script> | ||
<script src="//angular-ui.github.io/ui-ace/dist/ui-ace.min.js"></script> | ||
|
||
<script type="text/javascript"> | ||
angular.module("wookie", ['wookie.controllers','ngAnimate','ui.bootstrap', 'ui.ace']); | ||
angular.module("wookie.controllers", []) | ||
.controller('WookieCtrl', ['$scope', '$http', '$interval', function($scope, $http, $interval) { | ||
$scope.requestType = 'post'; | ||
$scope.url = '/resolve'; | ||
$scope.response = null; | ||
$scope.errors = null; | ||
|
||
$scope.inputHasChanged = false; | ||
|
||
$scope.checkModel = { | ||
optimize: false, | ||
disableNetwork: false, | ||
toArm: false, | ||
}; | ||
|
||
$scope.$watchCollection('checkModel', function() { | ||
$scope.sendRequest(); | ||
}); | ||
|
||
var cron = $interval(function() { | ||
if ($scope.inputHasChanged) { | ||
$scope.sendRequest(); | ||
} | ||
}, 1000); | ||
|
||
$scope.reqdata = "AAAAACAAAAGAAAATAAAC\n" + | ||
"AAGCAAAGGAAAGTAAA\n" + | ||
"AAGTGAAGTTAATACAATAGAAT\n" + | ||
"ACACGACACTACAGCACAGGACAGTACAT\n" + | ||
"ACCTGACCTTACGAGACGATACGCCACGCG\n" + | ||
"ACGCGACGCTACGGCACGGGACGGTAC\n" + | ||
"AGACTATACTCCACTCGACTCT\n" + | ||
"AGGCTAGGGCAGGGGAGGGTAGGTCAGGT\n" + | ||
"AGTAGATCAGATGAGATTAGCATAGCCC\n" + | ||
"ATTAGCATAGCCCAGCCGAGCCTAGCG\n" + | ||
"ATTCAATTGAATTTACACCACACG\n" + | ||
"CAACAGAACATAACCCAACCGA\n" + | ||
"CAGTCGAGTCTAGTGCAGTGGAGTGTAGTTCAG\n" + | ||
"CCATACCCCACCCGACCCTACC\n" + | ||
"CCATGCGATGCTATGGCATGGGATGGTATGT\n" + | ||
"CCTACCGCACCGGACCGTACCTCACCT\n" + | ||
"CCTAGCGCAGCGGAGCGTAGCTCAGCTGAGCTTA\n" + | ||
"CCTCCCGGCCCGTCCCTGCCCTTCCGCGCCGCTCC\n" + | ||
"CGAACCTAACGCAACGGAAC\n" + | ||
"CTTAAGACAAGAGAAGATAAGCC\n" + | ||
"CTTTGCTTTTGGGGGTGGGTTGGTGTGGT\n" + | ||
"GAACGTAACTCAACTGAACTTA\n" + | ||
"GATATTATCCCATCCGATCCTATCGCATCGGAT\n" + | ||
"GCTCCGGGCCGGTCCGTGCCGTTCCTCGCCT\n" + | ||
"GCTGAGCTTAGGATAGGCCAGGCGAGGCT\n" + | ||
"GGTACGTCACGTGACGTTACTAGACT\n" + | ||
"GTAAATCAAATGAAATTAACACAACAG\n" + | ||
"GTACATCACATGACATTACCAGACCATACC\n" + | ||
"GTATGTCATGTGATGTTATTCCATT\n" + | ||
"GTGTGGTTTGTGTTGTTTT\n" + | ||
"TAAACCAAACGAAACTAAAGCA\n" + | ||
"TAAGCCAAGCGAAGCTAAGG\n" + | ||
"TAAGGCAAGGGAAGGTAAGTCAAGTGA\n" + | ||
"TAGAATATAATCCAATCGAATCTAATGC\n" + | ||
"TAGTTCAGTTGAGTTTATATCATATGATATTA\n" + | ||
"TCAGGTGAGGTTAGTATAGTCCAG\n" + | ||
"TCGCCTCTCCTGGCCTGTCCTTGCCTTTCGCG\n" + | ||
"TCGGATCGTATCTCATCTGATCTTATGCCAT\n" + | ||
"TCGTCTCGTGGCGTGTCGTTGCG\n" + | ||
"TCTAATGCAATGGAATGTAATTCAA\n" + | ||
"TCTACTGCACTGGACTGTACTTCACTTG\n" + | ||
"TCTGGGCTGGTCTGTGCTGTTCTTGGCTTGTCTTTGCT\n" + | ||
"TGTCGTTGCGTTTCTCTGCTCTTCTGGGC\n" + | ||
"TTCCATTCGATTCTATTGCATTGGATTGTAT\n" + | ||
"TTCGCGGCGCGTCGCTGCGCTTCGG\n" + | ||
"TTCGGCTCGGGGCGGGTCGGTGCGGTTCGTCTCG\n" + | ||
"TTGACTTTAGAGCAGAGGAGAGTAG\n" + | ||
"TTGTATTTCATTTGATTTTCCCCCGCCCCTCCC\n"; | ||
|
||
$scope.inputLoaded = function(_editor) { | ||
$scope.inputEditor = _editor; | ||
}; | ||
$scope.outputLoaded = function(_editor) { | ||
$scope.outputEditor = _editor; | ||
}; | ||
$scope.inputChanged = function(e) { | ||
$scope.inputHasChanged = true; | ||
}; | ||
|
||
$scope.sendRequest = function(){ | ||
$scope.inputHasChanged = false; | ||
var data = { | ||
Sequences: $scope.reqdata, | ||
Options: { | ||
} | ||
}; | ||
$http.post($scope.url, data) | ||
.success(function(data,status,headers,config) { | ||
$scope.errors = {}; | ||
$scope.response = {}; | ||
$scope.response.data = data; | ||
$scope.response.status = status; | ||
$scope.response.headers = headers; | ||
$scope.response.config = config; | ||
$scope.outputEditor.setValue(data, 1); | ||
}) | ||
.error(function(data,status,headers,config) { | ||
$scope.errors = {}; | ||
$scope.response = {}; | ||
$scope.errors.data = data; | ||
$scope.errors.status = status; | ||
$scope.errors.headers = headers; | ||
$scope.errors.config = config; | ||
$scope.outputEditor.setValue(data, 1); | ||
}); | ||
}; | ||
}]); | ||
</script> | ||
|
||
<link rel="stylesheet" href="//netdna.bootstrapcdn.com/bootstrap/3.3.5/css/bootstrap.min.css"> | ||
<link rel="stylesheet" href="//cdnjs.cloudflare.com/ajax/libs/highlight.js/8.3/styles/github.min.css"> | ||
<style>.ace_editor { height: 600px; }</style> | ||
</head> | ||
<body ng-app="wookie"> | ||
<div class="container" ng-controller="WookieCtrl"> | ||
<div class="row"> | ||
<div class="page-header"> | ||
<h1>Wookie's genome</h1> | ||
</div> | ||
</div> | ||
<div class="row"> | ||
<div class="col-md-6"> | ||
<form name="dpform" ng-submit="sendRequest()" class="well"> | ||
<fieldset> | ||
<legend>Input</legend> | ||
<div class="container-fluid"> | ||
<div class="row"> | ||
<label for="reqdata">Sequences</label> | ||
<div ng-model="reqdata" name="reqdata" id="reqdata" language="text" | ||
ui-ace="{mode:'text',theme:'cobalt',onChange:inputChanged,onLoad:inputLoaded,useWrapMode:true}"> | ||
</div> | ||
</div> | ||
</div> | ||
</fieldset> | ||
</form> | ||
</div> | ||
<div class="col-md-6"> | ||
<div class="well"> | ||
<fieldset> | ||
<legend>Output</legend> | ||
<label>Genome</label> | ||
<div ui-ace="{mode:'text',theme:'cobalt',onLoad:outputLoaded,useWrapMode:true}" readonly></div> | ||
</fieldset> | ||
</div> | ||
</div> | ||
</div> | ||
</div> | ||
</body> | ||
</html> |
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.