New java.lang.ArrayIndexOutOfBoundsException: 44800 Issue

[mgfield]

I originally received the ArrayIndexOutOfBoundsException error in all my samples, and then updated to the 0.94 version, which solved most of my problems. However, in one of my sample sets, I am still getting the below error. In fact, one of the two matched samples used in this analysis was successfully analyzed in a different matched set... so maybe it is an issue specific to the second pair? Any suggestions about what might be going on? Is this another contig problem, but instead of mapping near the ends of MT, it is due to mapping near the end of GL000219?

Also, in the bwa fa.ann index file this region shows and other GL000219 reads map properly:
0 GL000219.1 dna:supercontig supercontig:GRCh37:GL000219.1:1:179198:1 REF
3097937706 179198 0

Index error for read: HW-ST997_0199:1:1311:7476:93735#0 147 GL000219.1 179140 28 38H9S54M = 179140 -54 GAGAGATTGTTCTGGAACCCTATGTTACAGACAAACATTGAGACCATCGTTGCAGTGTTCTGG @@@@@@??@??@?@@@?@@@>??@?>?@@@@@@??@@??@@??@@?>??<>>???>?>>?>=> PG:Z:MarkDuplicates AM:i:4 NM:i:5 SM:i:4 PQ:i:492 UQ:i:240 AS:i:240

java.lang.ArrayIndexOutOfBoundsException: 44800
at abra.CompareToReference2.getBaseAsChar(CompareToReference2.java:368)
at abra.CompareToReference2.getRefBase(CompareToReference2.java:362)
at abra.CompareToReference2.numDifferences(CompareToReference2.java:198)
at abra.CompareToReference2.numMismatches(CompareToReference2.java:70)
at abra.SAMRecordUtils.getEditDistance(SAMRecordUtils.java:166)
at abra.Sam2Fastq.convert(Sam2Fastq.java:100)
at abra.ReAligner.sam2Fastq(ReAligner.java:795)
at abra.PreprocessReadsRunnable.go(PreprocessReadsRunnable.java:32)
at abra.AbraRunnable.run(AbraRunnable.java:20)
at java.util.concurrent.Executors$RunnableAdapter.call(Executors.java:471)
at java.util.concurrent.FutureTask.run(FutureTask.java:262)
at java.util.concurrent.ThreadPoolExecutor.runWorker(ThreadPoolExecutor.java:1145)
at java.util.concurrent.ThreadPoolExecutor$Worker.run(ThreadPoolExecutor.java:615)
at java.lang.Thread.run(Thread.java:745)
Abra JNI entry point v0.94, prefix: 7_99687202_99687369__5_66718093_66718396_1, read_length: 101, kmer_size: 13, min_node_freq: 2, min_$
Assembling: -> abra_tmp_MM134/7_99687202_99687369_contigs.fasta_k13
STOPPED_ON_REPEAT: 7_99688005_99688296
Done assembling(0): abra_tmp_MM134/7_99688005_99688296_contigs.fasta_k11, 0
STOPPED_ON_REPEAT: 7_99669418_99669836
Done assembling(0): abra_tmp_MM134/7_99669418_99669836_contigs.fasta_k23, 0
Done assembling(0): abra_tmp_MM134/7_99687202_99687369_contigs.fasta_k13, 1
STOPPED_ON_REPEAT: 7_99686862_99687038__19_7694492_7694795_1
Done assembling(0): abra_tmp_MM134/7_99686862_99687038_contigs.fasta_k13, 0
Done assembling(0): abra_tmp_MM134/7_99688653_99689143_contigs.fasta_k13, 2

And then it just ends... and FixMate says that the file is truncated. Please help.

[mozack]

Fixed in v0.95