Reasonably fast tool to trim pairs of primer sequences from sequencing reads. It supports paired-end short read data in FASTQ format. The reads should contain a primer sequence at the start of read 1 and read 2. Reads without a valid primer combination are filtered, not written to the output. It can be used on data where you know the exact list of primer (or other prefix) seuqences that should be present in the reads.
It attempts to match all the provided read 1 primer sequences to the beginning of
the read 1 sequence. For the matches, it checks the read 2 primers. It can use a
simple string equality test, or a dynamic programming approach if the number of
mismatches allowed (-m) is greater than zero.
./NSCtrim [options] \
PRIMER_FILE \
INPUT_FILE_R1 INPUT_FILE_R2 \
OUTPUT_FILE_R1 OUTPUT_FILE_R2
Allowed options:
-m [ --mismatches-per-primer ] arg (=0)
Maximum allowed mismatches in primer1
and primer2 (per primer).
-s [ --swapped-primer-pairs ] Also search for reverse primer in read
1 and forward primer in read 2
(non-polar amplicons).
-d [ --degenerate-primers ] Primers are specified as IUPAC
degenerate nucleotide codes.
-U [ --write-unmatched ] Inverted output condition - write reads
that don't match, untrimmed (for
troubleshooting).
-h [ --help ] Show this help message.
Example:
./NSCtrim primers.txt reads_R1.fastq.gz reads_R2.fastq.gz output_R1.fastq.gz output_R2.fastq.gz
The primer file should be an 3-column tab separated file without a header.
| Column | Value |
|---|---|
| 1 | Read 1 primer sequence. |
| 2 | Read 2 primer sequence. |
| 3 | Name of primer combination. Used in the output table only. |
Example:
AAAGGTTTATACCCTTCCCAGG AGGCAAACTGAGTTGGACGTG amp001
AACCAACTTTCGATCTCTTGTAG AGGCAAACTGAGTTGGACGTG amp002
The second column (Read 2 primer sequence) should contain the actual sequence to search for in the reads, which is the reverse complement of the DNA sequence to amplify.
Important warning for short amplicons:
If the length of any of the amplicons is less than the length of the sequence reads, extra caution is required. For example, if read 1 and read 2 are both 151 bases long, then there will be an issue if the sum of the length of one of the primers and its amplified region is less than 151 bases. Both read 1 and read 2 will then start with a primer sequence, then contain the full amplified region, and then also contain the other primer at the end of the read -- either in full or parts of it. NSCtrim makes no attempt to trim primers that are not at the beginning of the reads.
The recommended way to deal with short amplicons is to clean the data with fastp
( https://github.com/OpenGene/fastp ) AFTER running NSCtrim. fastp removes adapter sequences based
on overlap between read 1 and read 2. If the output of NSCtrim is processed with fastp, it will
treat the primer sequences at the end of the reads as adapters, and remove them.
Depending on the protocol used for preparing the amplicons, you may have longer amplicons that bridge several primer sites. These have to be explicitly included in the primer file in order to be written to the output.
For example if you have two amplicons positioned in the genome like this:
-----F1------R1-------F2-----R2-----
You may possibly get a product of forward primer F1 and reverse primer R2.
Some amplicon protocols create "non-polar" amplicons, where they can occur in the reverse order (this is quite unusual).
Use the option -s to search for combinations that have swapped the read 1 and read 2 primers.
In such a protocol if you have the following two amplicons:
| Forward primer | Reverse primer |
|---|---|
| A123 | B123 |
| C123 | D123 |
You would get this in the data:
| Read 1 | Read 2 |
|---|---|
| A123 | B123 |
| B123 | A123 |
| C123 | D123 |
| D123 | C123 |
The sequences are not reverse-complemented in any of these cases (apart from the fact that B123 and D123 should already be the reverse-complement of the amplified template DNA, as described above).
STDERR includes detalis about the tool version, parameters, progress and error status.
A table of the number of found primer sequences is written to STDOUT. This can optionally be redirected to a file using the shell.
Statically compiled executables for Linux are available on the release pages in Github.
There are different ways to use NSCtrim with Docker:
A) The docker images for the current development branch (main) and future releases are automatically generated on each commit. You can find the information here:
https://github.com/orgs/nsc-norway/packages/container/package/nsctrim
B) You can build the program from source inside docker, creating a docker image with the NSCtrim tool.
Clone this git repository, and then run make docker. The docker image nsctrim:VERSION will be created locally.
The version number is determined from the currently checked out git tag, but you can override this version by
setting the environment variable VERSION. The command NSCtrim is available on the path inside the docker image.
C) You can even create a docker image more directly using the github URL. You have to give it the version manually, for the purpose of printing the version in the tool's output (suggestions for how to fix it are welcome). Specify any tag to build -- 1.3.1 in the example:
docker build -t nsctrim:1.3.1 https://github.com/nsc-norway/NSCtrim.git#1.3.1 --build-arg VERSION=1.3.1
You can build the program using a C++ compiler.
Requirements:
- C++ compiler
- GNU Make
- Development files for the following libraries, from Boost:
iostreamsprogram-options
- zlib (
libz)
As an example, you can install the following packages with apt on Ubuntu 20.04 to install the requirements:
build-essentiallibboost-iostreams-devlibboost-program-options-devlibz-dev
On FreeBSD 12: Install with pkg install:
devel/boost-alllang/gcc
Set environment variable:
CFLAGS="-I/usr/local/include -L/usr/local/lib"
After installing dependencies (any platform): Run make to make a dynamically linked executable.
Run make NSCtrim.static to make a statically linked executable. This can be used on Linux computers that don't have Boost installed. (you can rename the file to NSCtrim)
The version string is taken automatically from the currently committed git tag. To define your own version, commit the changes (locally) and create a tag with git tag.
There is no installation, but you can copy the file to /usr/bin to be able to run it on the command line.