RNA-Seq tutorial

Build a proof of concept of a RNA-Seq pipeline intended to show Nextflow scripting and reproducibility capabilities.

Prerequisits

IDE

Visual Code Studio IDE - this is recommended IDE for working with Nextflow.

Additionally install the following extensions:

1. Nextflow
2. Docker

Docker

Two docker images will be used in this experiment:

1. nextflow/project-base is container to unify our working environments. It is able to execute nextflow.
2. nextflow/rnatoy is a container that can contains simple rna-seq processing tools. It will be used to perform processing.

Pull the required Dockers with:

`make pull`

or build one of them with:

`make build`

Start

Checkout git tag task1-checkpoint to set your repository in the starting point.

You can use:

git checkout -b my-solution task1-checkpoint

This will create branch my-solution for you on which you can commit your steps.

Task 1

1. Create a nextflow.config basic based on documentation that includes:

   • enables docker by default, otherwise nextflow will try to execute all processes in your local environment
   • indicates what container to use (nextflow/rnatoy:latest)
   • indicates that reports from execution are created by default in reports/report.html

   The file is started for you.

2. Create main.nf based on nextflow basic example that takes both [data/ggal/ggal_gut_1.fq,data/ggal/ggal_gut_2.fq] and prints each record in standard output in one process.

   The file is started for you.

3. Use make run to execute the pipeline.

In result after running the pipeline, in terminal you should see loads of DNA lines similar to those below.

...
GGCGTAGCCACCAACTGCTTGACGACTTCATTTCCAAAAAGCAGGATTTAATGAGTCTGGAGCACAAGTCTTATGAGGAGCAGCTGAGGGAACTGGGATTGCTTA
GGTTGGCCTCTTTTCCCACATAACTAGCAGTAGGACTAGAGGGGATGGCCTCAGTTTCGCGGCAGGGAAGATTCAGGTTGGGTGTTAGGAAAAGTTTCTCTGAAA
GAGGAGGGTCAGGCACTGGAATGGGCTGCCCAGGGTGGTGGAGTCACCATCCCTGTTGGGGATCAAGAAACATTTCACTGTGGTACTGAGGGATGTGGTTTAGTG
GGGGAGAGTCGGGTTGGGTGTTAGGAAAAGTTTCTCTGAAAGGGATGGTCAGGCACTGGAATGGGCTGCCCAGGGTGGTGGAGTCACCATCCCTGTTGGGGATCA
GGATGGCCTCAGTTTCGCGGCAGGGAAGATTCAGGTTGGGTGTTAGGAAAAGTTTCTCTGAAAGGGATGGTCAGGCACTGGAATGGGCTGCCCAGGGTGGTGGAG
...

If you have trouble achieving this effect, check the solution by checking out, the starting point for task 2. Checkout task2-checkpoint and execute make run. If you achieved this, you can just progress to the next task.

Task 2

1. Start building RnaSeq pipeline by modifying main.nf to have 1 stage called buildIndex. For the provided genome: data/ggal/ggal_1_48850000_49020000.Ggal71.500bpflank.fa, build index with the following bowtie command:

       bowtie2-build ${genome} genome.index
   

2. The result should be published in the results folder. See reference for publishDir directive.

3. Run the pipeline. You should see 6 files appear in the results folder:

genome.index.1.bt2  
genome.index.2.bt2  
genome.index.3.bt2  
genome.index.4.bt2  
genome.index.rev.1.bt2  
genome.index.rev.2.bt2

If you have trouble achieving this effect, check the solution by checking out, the starting point for the next task. Checkout task3-checkpoint and execute make run. If you achieved this, you can just progress to the next task.

Task 3

In this task you add another stage to your pipeline called mapping. In result you should have a 2 stage pipeline that firstly indexes the genome and then maps the indexed genome obtained bam files.

1. Create channel that contains read pairs (i.e. pairs of fastq files) as in (ggal_gut_1.fq, ggal_gut_2.fq). See documentation for Channel factory and fromFilePairs.

2. Create mapping process

3. Define 2 inputs:

   • accept genome index from previous stage
   • accept reads from read pairs channel with something like: set pair_id, file(reads) from read_pairs

4. Add command to be executed: tophat2 genome.index ${reads}

5. tophat2 by default creates results in tophat_out/. We are interested in tophat_out/accepted_hits.bam. Rename this file by using pair_id to $pair_id.bam.

6. The result should be published in the results folder.

7. Run the pipeline. You should see 2 files appear in the results/tophat_oout folder:

ggal_gut.bam
ggal_liver.bam

If you have trouble achieving this effect, check the solution by checking out, the starting point for the next task. Checkout task4-checkpoint and execute make run. If you achieved this, you can just progress to the next task.

Task 4

In this task you add last stage to your pipeline called makeTranscript. In result you should have a 3 stage pipeline that takes genome and produces transcripts.

1. Modify mapping to not to rename the tophat_out/accepted_hits.bam output any more.

2. Modify mapping to construct (pair_id, bam_file) tuple and push it to bam_files channel. Refer to set operator.

3. Create makeTranscript process

4. Construct input to accept pair_id and bam_file from the bam_files in the same way as it was created.

5. Run cufflinks tool on each bam_file without any additional arguments.

6. Rename the resulting transcripts.gtf to transcript_${pair_id}.gtf

7. The result should be published in the results folder.

8. Run the pipeline. You should see 2 files appear in the results folder:

transcript_ggal_gut.gtf
transcript_ggal_liver.gtf

If you have trouble achieving this effect, check the solution by checking out, the starting point for the next task. Checkout task5-checkpoint and execute make run. If you achieved this, you can just progress to the next task.

Task 5*

This task is additional for eager participants. It's all about refining your outputs and communication to the user.

1. Tag the processes that run in parallel to display which read pair they are processing. See documentation.

2. Display a message at the end of the workflow about whether it was successful or not. See documentation.

3. Investigate the report that is being generated on each run. See Tracing and visualisation section of documentation to see what other reports can be generated. Try generating them.

4. Limit the memory on mapping to 2 MB on mapping process with process selector, and define retries with higher memory so the pipeline passes by using dynamic computing resources.

Partial solution can be found by checking out the final-solution-checkpoint tag.

Additional resources

See other tutorials to learn more:

1. Lifebit tutorial includes introduction to FlowCraft tool and Deploit web interface for running pipelines.
2. NF-Hack 2017 tutorial written by author of Nextlow, Paulo Di Tommaso, introduces usage of Singularity containers instead of Docker.