Command tool for metagenomic binning with deep learning, handles both short and long reads.
CONTACT US: Please use GitHub issues for bug reports and the SemiBin users mailing-list for more open-ended discussions or questions.
If you use this software in a publication please cite:
Pan, S.; Zhu, C.; Zhao, XM.; Coelho, LP. A deep siamese neural network improves metagenome-assembled genomes in microbiome datasets across different environments. Nat Commun 13, 2326 (2022). https://doi.org/10.1038/s41467-022-29843-y
The self-supervised approach and the algorithms used for long-read datasets (as well as their benchmarking) are described in
Pan, S.; Zhao, XM; Coelho, LP. SemiBin2: self-supervised contrastive learning leads to better MAGs for short- and long-read sequencing. bioRxiv preprint 2023.01.09.523201; https://doi.org/10.1101/2023.01.09.523201 (Accepted at Bioinformatics)
The functionality of SemiBin2 is available already since version 1.4!
- To use the self-supervised learning mode, use options
--self-supervised
- If you are using long-reads, use option
--sequencing-type=long_read
A tutorial of running SemiBin from scrath can be found here SemiBin tutorial.
Installation:
conda create -n SemiBin
conda activate SemiBin
conda install -c conda-forge -c bioconda semibin
The inputs to the SemiBin are contigs (assembled from the reads) and BAM files (reads mapping to the contigs). In the docs you can see how to generate the inputs starting with a metagenome.
Running with single-sample binning (for example: human gut samples):
SemiBin single_easy_bin -i contig.fa -b S1.sorted.bam -o output --environment human_gut
(if you are using contigs from long-reads, add the --sequencing-type=long_read
argument).
Running with multi-sample binning:
SemiBin multi_easy_bin -i contig_whole.fa -b *.sorted.bam -o output
The output includes the bins in the output_recluster_bins
directory (including the bin.*.fa and recluster.*.fa).
Please find more options and details below and read the docs.
SemiBin runs on Python 3.7-3.11.
The simplest mode is shown above. However, if you want to use SemiBin with GPU (which is faster if you have one available), you need to install PyTorch with GPU support:
conda create -n SemiBin
conda activate SemiBin
conda install -c conda-forge -c bioconda semibin
conda install -c pytorch-lts pytorch torchvision torchaudio cudatoolkit=10.2 -c pytorch-lts
MacOS note: you can only install the CPU version of PyTorch in MacOS with conda
and you need to install from source to take advantage of a GPU (see #72).
For more information on how to install PyTorch, see their documentation.
You will need the following dependencies:
The easiest way to install the dependencies is with conda:
conda install -c conda-forge -c bioconda mmseqs2=13.45111 # (for GTDB support)
conda install -c bioconda bedtools hmmer prodigal samtools
conda install -c bioconda fraggenescan
Once the dependencies are installed, you can install SemiBin by running:
python setup.py install
SemiBin runs on single-sample, co-assembly and multi-sample binning. Here we show the simple modes as an example. For the details and examples of every SemiBin subcommand, please read the docs.
Since version 1.4, SemiBin proposes new algorithm (ensemble based DBSCAN algorithm) for binning assemblies from long reads.
To use it, you can used the subcommands bin_long
or pass the option --sequencing-type=long_read
to the single_easy_bin
or multi_easy_bin
subcommands.
Since version 1.3, SemiBin supports completely self-supervised learning, which bypasses the need to annotate contigs with MMSeqs2.
In benchmarks, self-supervised learning is both faster (4x faster; using only 11% of RAM at peak) and generates 8.3-21.5% more high-quality bins compared to the version tested in the manuscript
To use it, pass the option --training-mode=self
to the single_easy_bin
or multi_easy_bin
subcommands.
Single sample and co-assembly are handled the same way by SemiBin.
You will need the following inputs:
- A contig file (
contig.fa
in the example below) - BAM file(s) from mapping short reads to the contigs, sorted (
mapped_reads.sorted.bam
in the example below)
The single_easy_bin
command can be used to produce results in a single step.
For example:
SemiBin \
single_easy_bin \
--input-fasta contig.fa \
--input-bam mapped_reads.sorted.bam \
--environment human_gut \
--output output
Alternatively, you can train a new model for that sample, by not passing in the --environment
flag:
SemiBin \
single_easy_bin \
--input-fasta contig.fa \
--input-bam mapped_reads.sorted.bam \
--output output
The following environments are supported:
human_gut
dog_gut
ocean
soil
cat_gut
human_oral
mouse_gut
pig_gut
built_environment
wastewater
chicken_caecum
(Contributed by Florian Plaza Oñate)global
The global
environment can be used if none of the others is appropriate.
Note that training a new model can take a lot of time and disk space.
Some patience will be required.
If you have a lot of samples from the same environment, you can also train a new model from them and reuse it.
The multi_easy_bin
command can be used in multi-samples binning mode:
You will need the following inputs:
- A combined contig file
- BAM files from mapping
For every contig, format of the name is <sample_name>:<contig_name>
, where
:
is the default separator (it can be changed with the --separator
argument). NOTE: Make sure the sample names are unique and the separator
does not introduce confusion when splitting. For example:
>S1:Contig_1
AGATAATAAAGATAATAATA
>S1:Contig_2
CGAATTTATCTCAAGAACAAGAAAA
>S1:Contig_3
AAAAAGAGAAAATTCAGAATTAGCCAATAAAATA
>S2:Contig_1
AATGATATAATACTTAATA
>S2:Contig_2
AAAATATTAAAGAAATAATGAAAGAAA
>S3:Contig_1
ATAAAGACGATAAAATAATAAAAGCCAAATCCGACAAAGAAAGAACGG
>S3:Contig_2
AATATTTTAGAGAAAGACATAAACAATAAGAAAAGTATT
>S3:Contig_3
CAAATACGAATGATTCTTTATTAGATTATCTTAATAAGAATATC
You can use this to get the combined contig:
SemiBin concatenate_fasta -i contig*.fa -o output
If either the sample or the contig names use the default separator (:
), you will need to change it with the --separator
,-s
argument.
After mapping samples (individually) to the combined FASTA file, you can get the results with one line of code:
SemiBin multi_easy_bin -i concatenated.fa -b *.sorted.bam -o output
The output folder will contain:
- Features computed from the data and used for training and clustering
- Saved semi-supervised deep learning model
- Output bins
- Table with basic information about each bin
- Some intermediate files
By default, reconstructed bins are in output_recluster_bins
directory.
For more details about the output, read the docs.