Chapter2.ipynb

{
 "cells": [
  {
   "cell_type": "code",
   "execution_count": 2,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Hello World\n"
     ]
    }
   ],
   "source": [
    "print(\"Hello World\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 3,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Hello World\n",
      "Hello World\n"
     ]
    }
   ],
   "source": [
    "print(\"Hello World\")\n",
    "print('Hello World')"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 4,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "She said, 'Hello World'\n",
      "He said, \"Hello World\"\n"
     ]
    }
   ],
   "source": [
    "print(\"She said, 'Hello World'\")\n",
    "print('He said, \"Hello World\"')"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 5,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Comments are very useful\n"
     ]
    }
   ],
   "source": [
    "# this is a comment, the computer will not read it\n",
    "print(\"Comments are very useful\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 6,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Monday is my favourite day of the week\n"
     ]
    }
   ],
   "source": [
    "# print(\"Hello World\")\n",
    "print(\"Monday is my favourite day of the week\")"
   ]
  },
  {
   "cell_type": "raw",
   "metadata": {},
   "source": [
    "print(\"Hello world\")"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### Chapter 2\n",
    "Introduction to Python"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 7,
   "metadata": {},
   "outputs": [
    {
     "ename": "SyntaxError",
     "evalue": "invalid syntax (<ipython-input-7-50b4ae29d403>, line 1)",
     "output_type": "error",
     "traceback": [
      "\u001b[0;36m  File \u001b[0;32m\"<ipython-input-7-50b4ae29d403>\"\u001b[0;36m, line \u001b[0;32m1\u001b[0m\n\u001b[0;31m    print(Hello world)\u001b[0m\n\u001b[0m                ^\u001b[0m\n\u001b[0;31mSyntaxError\u001b[0m\u001b[0;31m:\u001b[0m invalid syntax\n"
     ]
    }
   ],
   "source": [
    "print(Hello world)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 8,
   "metadata": {},
   "outputs": [
    {
     "ename": "NameError",
     "evalue": "name 'prin' is not defined",
     "output_type": "error",
     "traceback": [
      "\u001b[0;31m---------------------------------------------------------------------------\u001b[0m",
      "\u001b[0;31mNameError\u001b[0m                                 Traceback (most recent call last)",
      "\u001b[0;32m<ipython-input-8-016c1210ca52>\u001b[0m in \u001b[0;36m<module>\u001b[0;34m\u001b[0m\n\u001b[0;32m----> 1\u001b[0;31m \u001b[0mprin\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0;34m\"Hello World\"\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0m",
      "\u001b[0;31mNameError\u001b[0m: name 'prin' is not defined"
     ]
    }
   ],
   "source": [
    "prin(\"Hello World\")"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "Hello\n",
    "\n",
    "World"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 9,
   "metadata": {},
   "outputs": [
    {
     "ename": "SyntaxError",
     "evalue": "EOL while scanning string literal (<ipython-input-9-af165853920f>, line 1)",
     "output_type": "error",
     "traceback": [
      "\u001b[0;36m  File \u001b[0;32m\"<ipython-input-9-af165853920f>\"\u001b[0;36m, line \u001b[0;32m1\u001b[0m\n\u001b[0;31m    print(\"Hello\u001b[0m\n\u001b[0m                ^\u001b[0m\n\u001b[0;31mSyntaxError\u001b[0m\u001b[0;31m:\u001b[0m EOL while scanning string literal\n"
     ]
    }
   ],
   "source": [
    "print(\"Hello\n",
    "      World\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 10,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Hello\n",
      "World\n"
     ]
    }
   ],
   "source": [
    "print(\"Hello\\nWorld\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 11,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Hello\n",
      "\n",
      "World\n"
     ]
    }
   ],
   "source": [
    "print(\"Hello\\n\\nWorld\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 12,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Hello\tWorld\n"
     ]
    }
   ],
   "source": [
    "print(\"Hello\\tWorld\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 14,
   "metadata": {},
   "outputs": [],
   "source": [
    "my_dna = \"ACTCGTA\""
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 15,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "ACTCGTA\n"
     ]
    }
   ],
   "source": [
    "print(my_dna)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 16,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "my_dna\n"
     ]
    }
   ],
   "source": [
    "print(\"my_dna\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 17,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "ACTCGTA\n"
     ]
    }
   ],
   "source": [
    "banana = \"ACTCGTA\"\n",
    "print(banana)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 18,
   "metadata": {},
   "outputs": [],
   "source": [
    "my_dna1 = \"ACTG\""
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 19,
   "metadata": {},
   "outputs": [],
   "source": [
    "My_DNA = \"actg\""
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 20,
   "metadata": {},
   "outputs": [
    {
     "ename": "SyntaxError",
     "evalue": "cannot assign to operator (<ipython-input-20-24c057164406>, line 1)",
     "output_type": "error",
     "traceback": [
      "\u001b[0;36m  File \u001b[0;32m\"<ipython-input-20-24c057164406>\"\u001b[0;36m, line \u001b[0;32m1\u001b[0m\n\u001b[0;31m    my-dna = \"actg\"\u001b[0m\n\u001b[0m    ^\u001b[0m\n\u001b[0;31mSyntaxError\u001b[0m\u001b[0;31m:\u001b[0m cannot assign to operator\n"
     ]
    }
   ],
   "source": [
    "my-dna = \"actg\""
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 21,
   "metadata": {},
   "outputs": [
    {
     "ename": "SyntaxError",
     "evalue": "invalid syntax (<ipython-input-21-e52d328be840>, line 1)",
     "output_type": "error",
     "traceback": [
      "\u001b[0;36m  File \u001b[0;32m\"<ipython-input-21-e52d328be840>\"\u001b[0;36m, line \u001b[0;32m1\u001b[0m\n\u001b[0;31m    1dna = \"actg\"\u001b[0m\n\u001b[0m     ^\u001b[0m\n\u001b[0;31mSyntaxError\u001b[0m\u001b[0;31m:\u001b[0m invalid syntax\n"
     ]
    }
   ],
   "source": [
    "1dna = \"actg\""
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 22,
   "metadata": {},
   "outputs": [],
   "source": [
    "my_file = \"file.txt\""
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 23,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "AATTGGCC\n"
     ]
    }
   ],
   "source": [
    "my_dna = \"AATT\" + \"GGCC\"\n",
    "print(my_dna)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 24,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "AAAATGC\n"
     ]
    }
   ],
   "source": [
    "upstream = \"AAA\"\n",
    "my_dna = upstream + \"ATGC\"\n",
    "print(my_dna)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 25,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "AAAATGCGGG\n"
     ]
    }
   ],
   "source": [
    "upstream = \"AAA\"\n",
    "downstream = \"GGG\"\n",
    "my_dna = upstream + \"ATGC\" + downstream\n",
    "print(my_dna)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 26,
   "metadata": {},
   "outputs": [
    {
     "ename": "SyntaxError",
     "evalue": "invalid syntax (<ipython-input-26-f9f24de4ea7b>, line 3)",
     "output_type": "error",
     "traceback": [
      "\u001b[0;36m  File \u001b[0;32m\"<ipython-input-26-f9f24de4ea7b>\"\u001b[0;36m, line \u001b[0;32m3\u001b[0m\n\u001b[0;31m    my_dna = upstream \"ATGC\" + downstream\u001b[0m\n\u001b[0m                      ^\u001b[0m\n\u001b[0;31mSyntaxError\u001b[0m\u001b[0;31m:\u001b[0m invalid syntax\n"
     ]
    }
   ],
   "source": [
    "upstream = \"AAA\"\n",
    "downstream = \"GGG\"\n",
    "my_dna = upstream \"ATGC\" + downstream\n",
    "print(my_dna)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 27,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "AAAATGCGGG\n"
     ]
    }
   ],
   "source": [
    "upstream = \"AAA\"\n",
    "downstream = \"GGG\"\n",
    "my_dna = upstream+\"ATGC\"+downstream\n",
    "print(my_dna)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 28,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "Hello World\n"
     ]
    }
   ],
   "source": [
    "print(\"Hello\" + \" \" + \"World\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 29,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "HelloWorld\n"
     ]
    }
   ],
   "source": [
    "print(\"Hello\" + \"\" + \"World\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 30,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "4\n"
     ]
    }
   ],
   "source": [
    "dna_length = len(\"AGTC\")\n",
    "print(dna_length)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 31,
   "metadata": {},
   "outputs": [
    {
     "ename": "TypeError",
     "evalue": "can only concatenate str (not \"int\") to str",
     "output_type": "error",
     "traceback": [
      "\u001b[0;31m---------------------------------------------------------------------------\u001b[0m",
      "\u001b[0;31mTypeError\u001b[0m                                 Traceback (most recent call last)",
      "\u001b[0;32m<ipython-input-31-ccda32ed0748>\u001b[0m in \u001b[0;36m<module>\u001b[0;34m\u001b[0m\n\u001b[1;32m      1\u001b[0m \u001b[0mmy_dna\u001b[0m \u001b[0;34m=\u001b[0m \u001b[0;34m\"ACTGCAG\"\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[1;32m      2\u001b[0m \u001b[0mdna_length\u001b[0m \u001b[0;34m=\u001b[0m \u001b[0mlen\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0mmy_dna\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0;32m----> 3\u001b[0;31m \u001b[0mprint\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0;34m\"The length of the DNA sequence is:\"\u001b[0m \u001b[0;34m+\u001b[0m \u001b[0mdna_length\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0m",
      "\u001b[0;31mTypeError\u001b[0m: can only concatenate str (not \"int\") to str"
     ]
    }
   ],
   "source": [
    "my_dna = \"ACTGCAG\"\n",
    "dna_length = len(my_dna)\n",
    "print(\"The length of the DNA sequence is:\" + dna_length)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 32,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "The length of the DNA sequence is:7\n"
     ]
    }
   ],
   "source": [
    "my_dna = \"ACTGCAG\"\n",
    "dna_length = len(my_dna)\n",
    "print(\"The length of the DNA sequence is:\" + str(dna_length))"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 33,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "10\n"
     ]
    }
   ],
   "source": [
    "my_total = 7 + 3\n",
    "print(my_total)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 34,
   "metadata": {},
   "outputs": [
    {
     "ename": "TypeError",
     "evalue": "can only concatenate str (not \"int\") to str",
     "output_type": "error",
     "traceback": [
      "\u001b[0;31m---------------------------------------------------------------------------\u001b[0m",
      "\u001b[0;31mTypeError\u001b[0m                                 Traceback (most recent call last)",
      "\u001b[0;32m<ipython-input-34-c61e8356a17d>\u001b[0m in \u001b[0;36m<module>\u001b[0;34m\u001b[0m\n\u001b[0;32m----> 1\u001b[0;31m \u001b[0mmy_total\u001b[0m \u001b[0;34m=\u001b[0m \u001b[0;34m\"7\"\u001b[0m \u001b[0;34m+\u001b[0m \u001b[0;36m3\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0m\u001b[1;32m      2\u001b[0m \u001b[0mprint\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0mmy_total\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n",
      "\u001b[0;31mTypeError\u001b[0m: can only concatenate str (not \"int\") to str"
     ]
    }
   ],
   "source": [
    "my_total = \"7\" + 3\n",
    "print(my_total)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 35,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "73\n"
     ]
    }
   ],
   "source": [
    "my_total = \"7\" + \"3\"\n",
    "print(my_total)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 36,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "10\n"
     ]
    }
   ],
   "source": [
    "my_total = int(\"7\") + 3\n",
    "print(my_total)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 37,
   "metadata": {},
   "outputs": [
    {
     "ename": "ValueError",
     "evalue": "invalid literal for int() with base 10: '7,000,000'",
     "output_type": "error",
     "traceback": [
      "\u001b[0;31m---------------------------------------------------------------------------\u001b[0m",
      "\u001b[0;31mValueError\u001b[0m                                Traceback (most recent call last)",
      "\u001b[0;32m<ipython-input-37-b1a4260a1541>\u001b[0m in \u001b[0;36m<module>\u001b[0;34m\u001b[0m\n\u001b[0;32m----> 1\u001b[0;31m \u001b[0mmy_total\u001b[0m \u001b[0;34m=\u001b[0m \u001b[0mint\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0;34m\"7,000,000\"\u001b[0m\u001b[0;34m)\u001b[0m \u001b[0;34m+\u001b[0m \u001b[0;36m3\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0m\u001b[1;32m      2\u001b[0m \u001b[0mprint\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0mmy_total\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n",
      "\u001b[0;31mValueError\u001b[0m: invalid literal for int() with base 10: '7,000,000'"
     ]
    }
   ],
   "source": [
    "my_total = int(\"7,000,000\") + 3\n",
    "print(my_total)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 38,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "atgc\n"
     ]
    }
   ],
   "source": [
    "my_dna = \"ATGC\"\n",
    "# print my_dna in lower case\n",
    "print(my_dna.lower())"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 40,
   "metadata": {},
   "outputs": [
    {
     "ename": "NameError",
     "evalue": "name 'lower' is not defined",
     "output_type": "error",
     "traceback": [
      "\u001b[0;31m---------------------------------------------------------------------------\u001b[0m",
      "\u001b[0;31mNameError\u001b[0m                                 Traceback (most recent call last)",
      "\u001b[0;32m<ipython-input-40-465251caa9f1>\u001b[0m in \u001b[0;36m<module>\u001b[0;34m\u001b[0m\n\u001b[1;32m      1\u001b[0m \u001b[0mmy_dna\u001b[0m \u001b[0;34m=\u001b[0m \u001b[0;34m\"ATGC\"\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[1;32m      2\u001b[0m \u001b[0;31m# print my_dna in lower case\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0;32m----> 3\u001b[0;31m \u001b[0mprint\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0mlower\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0mmy_dna\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0m",
      "\u001b[0;31mNameError\u001b[0m: name 'lower' is not defined"
     ]
    }
   ],
   "source": [
    "my_dna = \"ATGC\"\n",
    "# print my_dna in lower case\n",
    "print(lower(my_dna))"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 41,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "4\n"
     ]
    },
    {
     "ename": "AttributeError",
     "evalue": "'int' object has no attribute 'lower'",
     "output_type": "error",
     "traceback": [
      "\u001b[0;31m---------------------------------------------------------------------------\u001b[0m",
      "\u001b[0;31mAttributeError\u001b[0m                            Traceback (most recent call last)",
      "\u001b[0;32m<ipython-input-41-02af54c595ae>\u001b[0m in \u001b[0;36m<module>\u001b[0;34m\u001b[0m\n\u001b[1;32m      1\u001b[0m \u001b[0mmy_length\u001b[0m \u001b[0;34m=\u001b[0m \u001b[0mlen\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0;34m\"ATGC\"\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[1;32m      2\u001b[0m \u001b[0mprint\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0mmy_length\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0;32m----> 3\u001b[0;31m \u001b[0mprint\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0mmy_length\u001b[0m\u001b[0;34m.\u001b[0m\u001b[0mlower\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0m",
      "\u001b[0;31mAttributeError\u001b[0m: 'int' object has no attribute 'lower'"
     ]
    }
   ],
   "source": [
    "my_length = len(\"ATGC\")\n",
    "print(my_length)\n",
    "print(my_length.lower())"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 42,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "<built-in method lower of str object at 0x7fe83c0a6270>\n"
     ]
    }
   ],
   "source": [
    "my_dna = \"ACTG\"\n",
    "print(my_dna.lower)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 43,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "<function print>"
      ]
     },
     "execution_count": 43,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "print"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 44,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "\n"
     ]
    }
   ],
   "source": [
    "print()"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 46,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "before: ATGC\n",
      "after: ATGC\n"
     ]
    }
   ],
   "source": [
    "my_dna = \"ATGC\"\n",
    "print(\"before: \" + my_dna)\n",
    "lowercase_dna = my_dna.lower()\n",
    "# print the variable again\n",
    "print(\"after: \" + my_dna)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 47,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "atgc\n"
     ]
    }
   ],
   "source": [
    "print(lowercase_dna)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 48,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "ATGC\n"
     ]
    }
   ],
   "source": [
    "print(lowercase_dna.upper())"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 51,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "ylspadktny\n",
      "ymtpadktnv\n",
      "vlspadktnv\n"
     ]
    }
   ],
   "source": [
    "protein = \"vlspadktnv\"\n",
    "# replace valine with tyrosine\n",
    "print(protein.replace(\"v\", \"y\"))\n",
    "# we can replace more than one character\n",
    "print(protein.replace(\"vls\", \"ymt\"))\n",
    "# the original variable is not affected\n",
    "print(protein)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 52,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "vlspadktnv\n"
     ]
    }
   ],
   "source": [
    "print(protein.replace('V', 'y'))"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 53,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "yvlspadktnyv\n"
     ]
    }
   ],
   "source": [
    "print(protein.replace('v', 'yv'))"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### Substrings or extracting part of a string"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 54,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "pa\n",
      "vls\n"
     ]
    }
   ],
   "source": [
    "protein = \"vlspadktnv\"\n",
    "# print from position 3 to position 5\n",
    "print(protein[3:5])\n",
    "# positions start at zero, not one\n",
    "print(protein[0:3])"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 56,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "pa\n",
      "vls\n"
     ]
    }
   ],
   "source": [
    "protein = \"vlspadktnv\"\n",
    "#          0123456789\n",
    "# print from position 3 to position 5\n",
    "print(protein[3:5])\n",
    "# positions start at zero, not one\n",
    "print(protein[0:3])"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 57,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "lsp\n"
     ]
    }
   ],
   "source": [
    "print(protein[1:4])"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 58,
   "metadata": {},
   "outputs": [
    {
     "ename": "SyntaxError",
     "evalue": "invalid syntax (<ipython-input-58-4daaf189ac7e>, line 1)",
     "output_type": "error",
     "traceback": [
      "\u001b[0;36m  File \u001b[0;32m\"<ipython-input-58-4daaf189ac7e>\"\u001b[0;36m, line \u001b[0;32m1\u001b[0m\n\u001b[0;31m    print(protein(1:4))\u001b[0m\n\u001b[0m                   ^\u001b[0m\n\u001b[0;31mSyntaxError\u001b[0m\u001b[0;31m:\u001b[0m invalid syntax\n"
     ]
    }
   ],
   "source": [
    "print(protein(1:4))"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 59,
   "metadata": {},
   "outputs": [
    {
     "ename": "TypeError",
     "evalue": "'int' object is not subscriptable",
     "output_type": "error",
     "traceback": [
      "\u001b[0;31m---------------------------------------------------------------------------\u001b[0m",
      "\u001b[0;31mTypeError\u001b[0m                                 Traceback (most recent call last)",
      "\u001b[0;32m<ipython-input-59-ac95d4c3b787>\u001b[0m in \u001b[0;36m<module>\u001b[0;34m\u001b[0m\n\u001b[1;32m      1\u001b[0m \u001b[0mmy_length\u001b[0m \u001b[0;34m=\u001b[0m \u001b[0mlen\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0;34m\"ACTGC\"\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0;32m----> 2\u001b[0;31m \u001b[0mprint\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0mmy_length\u001b[0m\u001b[0;34m[\u001b[0m\u001b[0;36m0\u001b[0m\u001b[0;34m:\u001b[0m\u001b[0;36m4\u001b[0m\u001b[0;34m]\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0m",
      "\u001b[0;31mTypeError\u001b[0m: 'int' object is not subscriptable"
     ]
    }
   ],
   "source": [
    "my_length = len(\"ACTGC\")\n",
    "print(my_length[0:4])"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 60,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "vlspadktnv\n"
     ]
    }
   ],
   "source": [
    "protein = \"vlspadktnv\"\n",
    "# we can select past the end of the string\n",
    "print(protein[0:60])\n"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 62,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "l\n"
     ]
    }
   ],
   "source": [
    "protein = \"vlspadktnv\"\n",
    "#          0123456789\n",
    "print(protein[1])"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 63,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "v\n"
     ]
    }
   ],
   "source": [
    "protein = \"vlspadktnv\"\n",
    "#          0123456789\n",
    "print(protein[9])"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 64,
   "metadata": {},
   "outputs": [
    {
     "ename": "IndexError",
     "evalue": "string index out of range",
     "output_type": "error",
     "traceback": [
      "\u001b[0;31m---------------------------------------------------------------------------\u001b[0m",
      "\u001b[0;31mIndexError\u001b[0m                                Traceback (most recent call last)",
      "\u001b[0;32m<ipython-input-64-d2138388f60a>\u001b[0m in \u001b[0;36m<module>\u001b[0;34m\u001b[0m\n\u001b[1;32m      1\u001b[0m \u001b[0mprotein\u001b[0m \u001b[0;34m=\u001b[0m \u001b[0;34m\"vlspadktnv\"\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[1;32m      2\u001b[0m \u001b[0;31m#          0123456789\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0;32m----> 3\u001b[0;31m \u001b[0mprint\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0mprotein\u001b[0m\u001b[0;34m[\u001b[0m\u001b[0;36m10\u001b[0m\u001b[0;34m]\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0m",
      "\u001b[0;31mIndexError\u001b[0m: string index out of range"
     ]
    }
   ],
   "source": [
    "protein = \"vlspadktnv\"\n",
    "#          0123456789\n",
    "print(protein[10])"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 65,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "\n"
     ]
    }
   ],
   "source": [
    "protein = \"vlspadktnv\"\n",
    "#          0123456789\n",
    "print(protein[10:60])"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 67,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "valines: 2\n",
      "lsp: 1\n",
      "tryptophans: 0\n"
     ]
    }
   ],
   "source": [
    "protein = \"vlspadktnv\"\n",
    "# count amino acid residues\n",
    "valine_count = protein.count(\"v\")\n",
    "lsp_count = protein.count('lsp')\n",
    "tryptophan_count = protein.count('w')\n",
    "\n",
    "# print the counts\n",
    "print(\"valines: \" + str(valine_count))\n",
    "print(\"lsp: \" + str(lsp_count))\n",
    "print(\"tryptophans: \" + str(tryptophan_count))"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 2,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "2\n"
     ]
    }
   ],
   "source": [
    "my_dna = 'AAAA'\n",
    "aa_count = my_dna.count('AA')\n",
    "print(aa_count)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 4,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "2\n"
     ]
    }
   ],
   "source": [
    "my_dna = 'AAAA'\n",
    "AA_count = my_dna.count('AA')\n",
    "print(AA_count)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 5,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "2\n"
     ]
    }
   ],
   "source": [
    "my_dna = 'AAAA'\n",
    "banana = my_dna.count('AA')\n",
    "print(banana)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 7,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "3\n",
      "6\n",
      "-1\n"
     ]
    }
   ],
   "source": [
    "protein = \"vlspadktnv\"\n",
    "#          0123456789\n",
    "print(str(protein.find('p')))\n",
    "print(str(protein.find('kt')))\n",
    "print(str(protein.find('w')))"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 8,
   "metadata": {},
   "outputs": [
    {
     "ename": "SyntaxError",
     "evalue": "invalid syntax (<ipython-input-8-448e35d5e5a4>, line 4)",
     "output_type": "error",
     "traceback": [
      "\u001b[0;36m  File \u001b[0;32m\"<ipython-input-8-448e35d5e5a4>\"\u001b[0;36m, line \u001b[0;32m4\u001b[0m\n\u001b[0;31m    print(str(protein.find('kt')))\u001b[0m\n\u001b[0m    ^\u001b[0m\n\u001b[0;31mSyntaxError\u001b[0m\u001b[0;31m:\u001b[0m invalid syntax\n"
     ]
    }
   ],
   "source": [
    "protein = \"vlspadktnv\"\n",
    "#          0123456789\n",
    "print(str(protein.find('p'))\n",
    "print(str(protein.find('kt')))\n",
    "print(str(protein.find('w')))"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 9,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "3\n",
      "6\n",
      "-1\n"
     ]
    }
   ],
   "source": [
    "protein = \"vlspadktnv\"\n",
    "#          0123456789\n",
    "print(str(protein.find('p')))\n",
    "print(str(protein.find('kt')))\n",
    "print(str(protein.find('w')))"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 10,
   "metadata": {},
   "outputs": [
    {
     "ename": "TypeError",
     "evalue": "find() takes at least 1 argument (0 given)",
     "output_type": "error",
     "traceback": [
      "\u001b[0;31m---------------------------------------------------------------------------\u001b[0m",
      "\u001b[0;31mTypeError\u001b[0m                                 Traceback (most recent call last)",
      "\u001b[0;32m<ipython-input-10-8a4565e6cf18>\u001b[0m in \u001b[0;36m<module>\u001b[0;34m\u001b[0m\n\u001b[0;32m----> 1\u001b[0;31m \u001b[0mprint\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0mstr\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0mprotein\u001b[0m\u001b[0;34m.\u001b[0m\u001b[0mfind\u001b[0m\u001b[0;34m(\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m)\u001b[0m\u001b[0;34m\u001b[0m\u001b[0;34m\u001b[0m\u001b[0m\n\u001b[0m",
      "\u001b[0;31mTypeError\u001b[0m: find() takes at least 1 argument (0 given)"
     ]
    }
   ],
   "source": [
    "print(str(protein.find()))"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 14,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "0\n",
      "9\n"
     ]
    }
   ],
   "source": [
    "protein = \"vlspadktnv\"\n",
    "#          0123456789\n",
    "print(str(protein.find('v')))\n",
    "print(str(protein.find('v', 1)))"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 15,
   "metadata": {},
   "outputs": [],
   "source": [
    "my_dna = 'ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT'"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 16,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "2\n",
      "1\n",
      "4\n",
      "2.5\n"
     ]
    }
   ],
   "source": [
    "# add\n",
    "result = 1 + 1\n",
    "print(result)\n",
    "# subtract\n",
    "result = 2 - 1\n",
    "print(result)\n",
    "# multiply\n",
    "result = 2 * 2\n",
    "print(result)\n",
    "# divide\n",
    "result = 5 / 2\n",
    "print(result)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 21,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "AT count: 37\n",
      "my DNA length: 54\n",
      "AT content: 0.6851851851851852\n",
      "AT content %: 68.51851851851852\n"
     ]
    }
   ],
   "source": [
    "# AT content of my_dna\n",
    "a_count = my_dna.count('A')\n",
    "t_count = my_dna.count('T')\n",
    "at_count = a_count + t_count\n",
    "print(\"AT count: \" + str(at_count))\n",
    "my_dna_length = len(my_dna)\n",
    "print(\"my DNA length: \" + str(my_dna_length))\n",
    "at_content = at_count / my_dna_length\n",
    "print(\"AT content: \" + str(at_content))\n",
    "print(\"AT content %: \" + str(at_content * 100))"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 22,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "AT count: 33\n",
      "my DNA length: 54\n",
      "AT content: 0.6111111111111112\n",
      "AT content %: 61.111111111111114\n"
     ]
    }
   ],
   "source": [
    "my_dna = 'ACTGATCgattacGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT'\n",
    "# AT content of my_dna\n",
    "a_count = my_dna.count('A')\n",
    "t_count = my_dna.count('T')\n",
    "at_count = a_count + t_count\n",
    "print(\"AT count: \" + str(at_count))\n",
    "my_dna_length = len(my_dna)\n",
    "print(\"my DNA length: \" + str(my_dna_length))\n",
    "at_content = at_count / my_dna_length\n",
    "print(\"AT content: \" + str(at_content))\n",
    "print(\"AT content %: \" + str(at_content * 100))"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 23,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "AT count: 37\n",
      "my DNA length: 54\n",
      "AT content: 0.6851851851851852\n",
      "AT content %: 68.51851851851852\n"
     ]
    }
   ],
   "source": [
    "my_dna = 'ACTGATCgattacGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT'\n",
    "# AT content of my_dna\n",
    "a_count = my_dna.count('A') + my_dna.count('a')\n",
    "t_count = my_dna.count('T') + my_dna.count('t')\n",
    "at_count = a_count + t_count\n",
    "print(\"AT count: \" + str(at_count))\n",
    "my_dna_length = len(my_dna)\n",
    "print(\"my DNA length: \" + str(my_dna_length))\n",
    "at_content = at_count / my_dna_length\n",
    "print(\"AT content: \" + str(at_content))\n",
    "print(\"AT content %: \" + str(at_content * 100))"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 24,
   "metadata": {},
   "outputs": [
    {
     "name": "stdout",
     "output_type": "stream",
     "text": [
      "AT count: 37\n",
      "my DNA length: 54\n",
      "AT content: 0.6851851851851852\n",
      "AT content %: 68.51851851851852\n"
     ]
    }
   ],
   "source": [
    "my_dna = 'ACTGATCgattacGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT'\n",
    "# AT content of my_dna\n",
    "a_count = my_dna.upper().count('A')\n",
    "t_count = my_dna.upper().count('T')\n",
    "at_count = a_count + t_count\n",
    "print(\"AT count: \" + str(at_count))\n",
    "my_dna_length = len(my_dna)\n",
    "print(\"my DNA length: \" + str(my_dna_length))\n",
    "at_content = at_count / my_dna_length\n",
    "print(\"AT content: \" + str(at_content))\n",
    "print(\"AT content %: \" + str(at_content * 100))"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": null,
   "metadata": {},
   "outputs": [],
   "source": []
  }
 ],
 "metadata": {
  "kernelspec": {
   "display_name": "Python 3",
   "language": "python",
   "name": "python3"
  },
  "language_info": {
   "codemirror_mode": {
    "name": "ipython",
    "version": 3
   },
   "file_extension": ".py",
   "mimetype": "text/x-python",
   "name": "python",
   "nbconvert_exporter": "python",
   "pygments_lexer": "ipython3",
   "version": "3.8.1"
  }
 },
 "nbformat": 4,
 "nbformat_minor": 4
}