Installation and usage for various tools for cancer genomics
Qingxiang (Allen) Guo
Postdoctoral Fellow
Northwestern University, Feinberg School of Medicine
qingxiang.guo@northwestern.edu
In this section, I provide the installation and usage for a wide range of bioinformatics tools, especially for cancer genomics. This repo will be kept updating. Feedback or experience is warmly welcomed.
You can see which versions of R are available on Quest, and which version is the default, with the command
module spider RYou can make a particular version of R available to use by typing the full module name with the version included as listed in the output
module load R/4.2.0Go to the NCBI SRA site, select the SRA file you need and go to "Run selector" to got batch list in this way.
Use perl one-liner to process the header
perl -p -i -e 's/(\S+)\n/"$1", /g' listRevise the script and batch download with the python script:
# _*_ coding=utf-8 _*_
import subprocess
# Insert your SRR accession numbers here
sra_accession_number = ["SRR11951439", "SRR11951443", "SRR11951444", "SRR11951445", "SRR11951446", "SRR11951447", "SRR11951448",
"SRR11951449", "SRR11951450", "SRR11951451", "SRR11951452", "SRR11951453", "SRR11951454", "SRR11951455",
"SRR11951456", "SRR11951457", "SRR11951458", "SRR11951459", "SRR11951460", "SRR11951461", "SRR11951462",
"SRR11951463", "SRR11951464", "SRR11951465", "SRR11951466", "SRR11951467", "SRR11951468", "SRR11951469",
"SRR11951470", "SRR11951471", "SRR11951472", "SRR11951473", "SRR11951474", "SRR11951475", "SRR11951476",
"SRR11951477", "SRR11951478", "SRR11951479", "SRR11951480", "SRR11951481", "SRR11951482", "SRR11951483",
"SRR11951484", "SRR11951485", "SRR11951486", "SRR11951487", "SRR11951488", "SRR11951489", "SRR11951490",
"SRR11951491", "SRR11951492", "SRR11951493", "SRR11951494", "SRR11951495", "SRR11951496", "SRR11951497",
"SRR11951498", "SRR11951499", "SRR11951500", "SRR11951501", "SRR11951502", "SRR11951503", "SRR11951504",
"SRR11951505", "SRR11951506", "SRR11951507", "SRR11951508", "SRR11951509", "SRR11951510", "SRR11951511",
"SRR11951512", "SRR11951513", "SRR11951514", "SRR11951515", "SRR11951516", "SRR11951517", "SRR11951519",
"SRR11951520", "SRR11951521", "SRR11951522", "SRR11951523", "SRR11951524", "SRR11951525", "SRR11951526",
"SRR11951527", "SRR11951528", "SRR11951530", "SRR11951531", "SRR11951532", "SRR11951533", "SRR11951534",
"SRR11951535", "SRR11951536", "SRR11951537", "SRR11951542"]
# This will download the .sra files to ~/ncbi/public/sra/ (will create directory if not present)
for sra_id in sra_accession_number:
print("Current downloading" + sra_id)
prefetch_cmd = "prefetch " + sra_id + " -O /home/qgn1237/qgn1237/2_raw_data/smooth_seq_95_sc_K562_SMRT" # Note the space between commands
print("The running command is " + prefetch_cmd)
subprocess.call(prefetch_cmd, shell=True)
# This will create the fastq file from the downloaded sra file
for sra_id in sra_accession_number:
print("Creating fastq file for" + sra_id)
fasterq_dump_cmd = "fasterq-dump /home/qgn1237/qgn1237/2_raw_data/smooth_seq_95_sc_K562_SMRT/" + sra_id + " -O /home/qgn1237/qgn1237/2_raw_data/smooth_seq_95_sc_K562_SMRT/" + sra_id # Use the fstring here
print("The running command is " + fasterq_dump_cmd)
subprocess.call(fasterq_dump_cmd, shell=True)python batch_delete_all_sra_files.pyYou have to resource the mamba by yourself
#!/bin/bash
#SBATCH --account=b1042
#SBATCH --partition=genomics ## Required: (buyin, short, normal, long, gengpu, genhimem, etc)
#SBATCH --time=03:00:00 ## Required: How long will the job need to run (remember different partitions have restrictions on this parameter)
#SBATCH --nodes=1 ## how many computers/nodes do you need (no default)
#SBATCH --ntasks-per-node=6 ## how many cpus or processors do you need on per computer/node (default value 1)
#SBATCH --mem=35G ## how much RAM do you need per computer/node (this affects your FairShare score so be careful to not ask for more than you need))
#SBATCH --job-name=allen_download ## When you run squeue -u this is how you can identify the job
#SBATCH --output=output.log ## standard out and standard error goes to this file
# A regular comment in Bash
/home/qgn1237/2_software/mambaforge/bin/mamba init
source ~/.bashrc
mamba activate mamba666
minimap2 -d /home/qgn1237/qgn1237/1_my_database/GRCh38_p13/minimap2_index/GRCh38.p13.genome.mmi /projects/b1171/qgn1237/1_my_database/GRCh38_p13/GRCh38.p13.genome.fa -t 6python ./batch_create_directory_from_list.pyscancel -u NETIDscancel 35087 Solve the error when connecting quest using SSH client: client_global_hostkeys_private_confirm: server gave bad signature for RSA key 0
This might because the cliend delete your key file, and the server can't recognize you. Run the cmd to regenerate the keys:
/usr/bin/ssh-keygen -Aestimate_bam_genome_coverage.py
It will produce a coverage_list, exclude single cells that less than 10% coverage, and get a bad list
second_coloumn_smaller_than.py
calculate_genome_depth_fast.py <your BAM file>
sudo vim /etc/ssh/sshd_configThen edit the content: #ClientAliveInterval 900 #ClientAliveCountMax 10
sudo launchctl start com.openssh.sshdalias sq='squeue | grep "netid"'
alias cdd='cd ../../'
alias ma='mamba activate mamba666'
alias rl='readlink -f'
alias sb='sbatch'
alias lsn='less -SN'
alias vim='lvim'
alias ls='lsd'Add these lines to ~/.bash.rc then source
You can treat Nanopore MinION as a server itself. First, login into MinION with wifi, and get the IP address of MinION. Then, at your on PC terminal, type： ssh -x minit@. The it will ask you for the password. The password is: minit. Then you will login into MinION system.
Navigate the system, cd .. to the higher level of directory and find your data.
Then use the following command to transfer
rsync -avz /path/to/minion/files qgn1237@quest.northwestern.edu:/home/qgn1237
You can add --append-verify if you want to resume.
# Then it will ask you for the password of northwestern Questfor dir in */; do cd "$dir"; mkdir 10X_depth ; cd ..; doneGenerate sbatch cmd list by specifying the input file and the suffix you want, this can sava time and avoid mistake
# Edit the cmd = f"samtools view -s 0.384 -b {input_file_abs_path} -@ 8 > {input_file_base_name}.{suffix}" in generate_cmd.py to your desired command
./generate_cmd.py ../VCaP.bam 10X.bam
# Then excute in the directory where you want to store the ouput file
sbatch cmd_list
# You can customize the command as you like
./pbsv2_cmd.py 22Rv1_10X_sort.svsig.gz var.vcfecho 'PATH=$PATH:/home/qgn1237/1_script' >> ~/.bashrc
source ~/.bashrcfind_suffix_in_current_directory.py <suffix>filter_vcf_based_on_quality.py input.vcf 20 > output.vcfFor Iterm2 go to any folder and run command:
git clone https://github.com/dracula/iterm.git
cd iterm/ # Then go to the profiles panel of Iterm2, select your profiles, --> . colors, and import the Dracula.itermcolors file,
# Then select Dracula in color presets done!For Vimium,go into the Vimium addon's preferences, right-click the Vimium icon next to the address bar and select “Manage Extension.” On the Extensions page, paste https://raw.githubusercontent.com/dracula/vimium/master/vimium-dracula.css to CSS for Vimium UI
For Chrome, install in https://chrome.google.com/webstore/detail/dracula-chrome-theme/gfapcejdoghpoidkfodoiiffaaibpaem
Copy all the file including hidden files
cp -r ~/OneDrive\ -\ Northwestern\ University/deep_learning_math_theory/. ./
bash_cmd_to_python.pyfirst edit the file: ~/.ssh/config Add content:
Host quest
HostName quest.northwestern.edu
User XXX
Port 22create a SSH key and copy to server
ssh-keygen
# you will be prompted to enter a passphrase for the key, enter for no password. This is a password for password. Don't use it.
ssh-copy-id quest
# copy your public key to an existing server, it will prompt you for the password of the remote user’s account
# Type in the password (your typing will not be displayed for security purposes) and press ENTER.
# The utility will connect to the account on the remote host using the password you provided. It will then copy the contents of your
# ~/.ssh/id_rsa.pub key into a file in the remote account’s home ~/.ssh directory called authorized_keys.
# You should be able to log into the remote host without the remote account’s password
ssh questrsync -azvhP quest:~/R/ ./local
rsync -azvhP ./Tools-for-Cancer-Genome-Analysis/scripts/plot_VCF_chrom_freq_count.py quest:~/1_script/You need to install new gcc, cmake, and make
git clone https://github.com/neovim/neovim
cd neovim
mamba install -c conda-forge cmake # Install cmake
make CMAKE_INSTALL_PREFIX=/home/qgn1237/2_software/mambaforge/envs/mamba666/ # Avoid root
make install
# add alias
alias vim='nvim'brew install neovimfind ./ -name "my_software_overlapp*"for i in 22Rv1 DU145 LNCaP PC3 VCaP; do cd $i; for j in ./*depth; do rl $j/delly/*_filtered.vcf > $j/SURVIVOR/list_vcf; rl $j/manta/results/variants/tumorSV.vcf >> $j/SURVIVOR/list_vcf; done; cd ..; donecurl https://sh.rustup.rs -sSf | sh
# Type 1 and enter
fish_add_path /Users/qgn1237/.cargo/binYou can use cargo now.
cargo install rm-improved
# Then you will have 'rip' command
mkdir trash_can
# Remove file
rip t.p
# Undo the last deletion
rip -u
# Change the graveyard
export GRAVEYARD=/home/qgn1237/qgn1237/trash_can
# You can also udo specific files
rip -u # Uninstall and install matplotlib again
pip uninstall matplotlib
pip install matplotlibThe next gen ls command, a more intuitive version of du in rust
cargo install lsd
cargo install du-dust
# You can then alias the lsd to lscargo install fd-findYou can use it like,
fd vcf # part of the file name
fd -e vcf # Specific extensionmklink /D "OneDrive path/file_name" "/local/file_name"
Then the file will be automatically updated.
Starship is the minimal, blazing-fast, and infinitely customizable prompt for any shell! Let's install in quest first.
curl -O https://starship.rs/install.sh
chmod 755 install.sh
# Install to your own directory
./install.sh -b ~/.local/bin
# If you use bash shell, add the following to the end of ~/.bashrc:
# Before conda init block!
eval "$(starship init bash)"
source ~/.bashrc
# If you use mac Fish, add the following in the center ~/.config/fish/config.fish:
starship init fish | source
# Exit and you're done!Try to make a bin file if there is not. The /home/qgn1237/.local/bin will by default in your $PATH. So try to link or move the binary file of your different mamba/conda ENV in this directory, so you don't need to shift between ENV now.
For example
[qgn1237@quser23 ~]$ which vim
alias vim='nvim'
~/.local/bin/nvimFirst make sure you have installed Homebrew.
brew install fish
# Make sure that you've successfully installed Fish
fish --version
# Make Fish as your default shell
# Add /usr/local/bin/fish to your list of shells
# It should be noted that, for the M2 chip mac, homebrew will not install stuff
# in /usr/local/bin/fish , but /opt/homebrew/bin/fish
# Besides, the following command will not work
sudo echo /usr/local/bin/fish >> /etc/shells
Changing shell for qgn1237.
Password for qgn1237:
chsh: /usr/local/bin/fish: non-standard shell
# This is because, the latter doesn't work because the
# output redirection >> is (tried to be) applied by the shell
# before the sudo … is executed, and of course the user shell
# has no permission to do that.Instead, you should do:
echo /opt/homebrew/bin/fish | sudo tee -a /etc/shells
chsh -s /opt/homebrew/bin/fishExit and restart your shell, you'are done.
# Fish can do many little tricks
# Calculation
math 2/5
0.4I've rarely explore the other possibility besides bash, and I don't think comfort zone is a good sign for me. So I decide to switch to Fish, which seems to be more powerful.
# You can refer to https://yangyangli.top/posts/012-make-a-powerful-ternimal/
# Know your current shell
echo $SHELL
# Go to mamba environment
ma
# Build from source code
wget https://github.com/fish-shell/fish-shell/archive/refs/tags/3.6.0.tar.gz
tar zxf 3.6.0.tar.gz
cd fish-shell-3.6.0/
mkdir build
cd build
cmake -DCMAKE_INSTALL_PREFIX=$HOME/.local ..
# This would install fish and its associated files under $HOME/.local. The fish executable would be located in $HOME/.ocal/bin (which you may want to add to your $PATH).
make
make installWhen you type: fish, it shows: fish: error while loading shared libraries: libpcre2-32.so.0: cannot open shared object file: No such file or director
This because fish can not find the lib file, and you also don't have the permission to /usr/local/lib. The solution is to find the path of libpcre2-32.so.0
❯ find_suffix_in_current_directory.py libpcre2-32.so.0
./2_software/mambaforge/pkgs/pcre2-10.40-hc3806b6_0/lib/libpcre2-32.so.0
./2_software/mambaforge/envs/mamba_py_39/lib/libpcre2-32.so.0
./2_software/mambaforge/envs/mamba666/lib/libpcre2-32.so.0
echo 'export LD_LIBRARY_PATH=$LD_LIBRARY_PATH:~/2_software/mambaforge/pkgs/pcre2-10.40-hc3806b6_0/lib/' >> ~/.bashrc
source ~/.bashrc
# Type fish and you're good!
# Now make it as your default shell
vim ~/.config/fish/config.fish
# add
starship init fish | source
# When you go to fish, the starship will prompt automatically.Next step, let's make you to change to Fish automatically while connect to server. chsh won't do it without the shell being listed in /etc/shells, and other ways of editing that configuration also require root permissions.
# Add this to .bashrc
if [[ $- = *i* ]]; then
exec fish
fiNow you're all good, everytime you login into bash, bashrc will lead you to fish Then fish will start starship automatically.
# Upgrade your git command first
mamba install -c anaconda git
# Uninstall fish
rip /home/qgn1237/.local/etc/fish/
rip /home/qgn1237/.local/share/fish
rip /home/qgn1237/.config/fish
cd /home/qgn1237/.local/bin
rip fish fish_indent fish_key_reader
# Reinstall fish
git clone https://github.com/fish-shell/fish-shell.git
cd fish-shell/
cmake -DCMAKE_INSTALL_PREFIX=$HOME/.local .
make
make install
fish --version
# fish, version 3.6.0-24-g16369a3ab
# You're good now. The problem is because that the git is too old.
# Fish generates the version at build time with the build_tools/git_version_gen.sh scriptalias -s sq='squeue | grep "qgn1237"'
alias -s cdd='cd ../../'
alias -s ma='mamba activate mamba666'
alias -s rl='readlink -f'
alias -s sb='sbatch'
alias -s lsn='less -SN'
alias -s vim='lvim'
alias -s ls='lsd'
alias -s zcp='zellij action close-pane'
# That creates ~/.config/fish/functions/ls.fish which will then be available in any fish session.Or you can edit the fish rc file
vim ~/.config/fish/config.fish
# Add all the alis to thr fishrc fileYou will get error like:
Run 'mamba init' to be able to run mamba activate/deactivate and start a new shell session. Or use conda to activate/deactivate.
Fish will automatically load your .bashrc file. But you have to add mamba to fish manually.
# add the following to ~/.config/fish/config.fish
# Adapted from `function conda` printed by `conda shell.fish hook`, following
# `mamba.sh`.
function mamba --inherit-variable CONDA_EXE
if [ (count $argv) -lt 1 ]
$CONDA_EXE
else
set -l mamba_exe (dirname $CONDA_EXE)/mamba
set -l cmd $argv[1]
set -e argv[1]
switch $cmd
case activate deactivate
eval ($CONDA_EXE shell.fish $cmd $argv)
case install update upgrade remove uninstall
$mamba_exe $cmd $argv
and eval ($CONDA_EXE shell.fish reactivate)
case '*'
$mamba_exe $cmd $argv
end
end
end mamba init fish
# This will add lines to your fish rc fileNow you can do:
mamba activate mamba666
# Backup your rc file
cp ~/.config/fish/config.fish ~/.config/fish/config.fish.bkThe idea is to give mamba the power to do mamba activate like conda activate.
Oh My Fish provides core infrastructure to allow you to install packages which extend or modify the look of your shell. It's fast, extensible and easy to use.
curl https://raw.githubusercontent.com/oh-my-fish/oh-my-fish/master/bin/install > install
fish install --path=~/.local/share/omf --config=~/.config/omf
# Install aborted: Git version 1.9.5 or greater required; you have 1.8.3.1
mamba activate mamba666 # We have the new git here.
fish install --path=~/.local/share/omf --config=~/.config/omf
# It will succeed this time.omf install fish_logo
# Add this to your fish greeting with this function:
function fish_greeting
fish_logo
end
# Just write it to ~/.config/fish/functions/fish_greeting.fish
# You will see it every time you start a new session.
# All your available theme
omf theme
omf install bobthefishma # Go to mamba666 env with higher git version
omf destroystarship preset pastel-powerline > ~/.config/starship.tomlset -U fish_user_paths /opt/homebrew/bin $fish_user_pathsThis is a useful script from Tingyou Wang.
# n means the number of command you want to divide
divide -i cmd_list_332 -n 4
sub # Write by myselfThe fish shell language is more clean and comfortable.
for dir in (ls -d SRR11563614 SRR11563615 SRR11563616)
set source_dir "$dir/$dir"
set target_dir "$dir"
mv "$source_dir"/*.sra "$target_dir"
rip "$source_dir"
endA plugin manager for Fish—the friendly interactive shell.
curl -sL https://git.io/fisher | source && fisher install jorgebucaran/fisher
# Install functions
fisher install laughedelic/fish_logobrew install duti
# To set all text files and code files to vscode instead of xcode use this set of shell commands.
duti -s com.microsoft.VSCode public.json all
duti -s com.microsoft.VSCode public.plain-text all
duti -s com.microsoft.VSCode public.python-script all
duti -s com.microsoft.VSCode public.shell-script all
duti -s com.microsoft.VSCode public.source-code all
duti -s com.microsoft.VSCode public.text all
duti -s com.microsoft.VSCode public.unix-executable all
# this works for files without a filename extension
duti -s com.microsoft.VSCode public.data all
duti -s com.microsoft.VSCode .c all
duti -s com.microsoft.VSCode .cpp all
duti -s com.microsoft.VSCode .cs all
duti -s com.microsoft.VSCode .css all
duti -s com.microsoft.VSCode .go all
duti -s com.microsoft.VSCode .java all
duti -s com.microsoft.VSCode .js all
duti -s com.microsoft.VSCode .sass all
duti -s com.microsoft.VSCode .scss all
duti -s com.microsoft.VSCode .less all
duti -s com.microsoft.VSCode .vue all
duti -s com.microsoft.VSCode .cfg all
duti -s com.microsoft.VSCode .json all
duti -s com.microsoft.VSCode .jsx all
duti -s com.microsoft.VSCode .log all
duti -s com.microsoft.VSCode .lua all
duti -s com.microsoft.VSCode .md all
duti -s com.microsoft.VSCode .php all
duti -s com.microsoft.VSCode .pl all
duti -s com.microsoft.VSCode .py all
duti -s com.microsoft.VSCode .rb all
duti -s com.microsoft.VSCode .ts all
duti -s com.microsoft.VSCode .tsx all
duti -s com.microsoft.VSCode .txt all
duti -s com.microsoft.VSCode .conf all
duti -s com.microsoft.VSCode .yaml all
duti -s com.microsoft.VSCode .yml all
duti -s com.microsoft.VSCode .toml all# You can save this whole directory, make your transfer and installation easier
/home/qgn1237/.config# autopair.fish, auto-complete matching pairs in the Fish command line. Type pair () for you.
fisher install jorgebucaran/autopair.fishz tracks the directories you visit. With a combination of frequency and recency,
it enables you to jump to the directory in mind.
# Install
fisher install jethrokuan/z
z foo: Goes to directory best matching foo.
zo foo: Opens file manager of directory best matching foo.
z -t foo: Goes to most recent directory matching foo.
z -x: Removes the current directory from $Z_DATA.chr1 10837 svim.INS.4 N 8 PASS SVTYPE=INS;END=10837;SVLEN=79;SUPPORT=7;STD_SPAN=5.8;STD_POS=40.06 GT:DP:AD 0/1:30:23,7
It is possible to calculate the allele frequency from the AD info in this specific structural variants VCF file. The AD field lists the depth of coverage for each allele at a particular variant site, in this case, the AD field has two values separated by a comma (23, 7). To calculate the frequency, you can divide the number of reads supporting the alternate allele (7) by the total number of reads (23 + 7 = 30). So the allele frequency would be 7/30 = 0.23 or 23%.
DP4 is another form of SVC
DP4=0,0,14,12;
DP4 reports the number of reads covering the position with the reference allele mapped to forward and reverse strands, followed by alternate allele mapped to forward and reverse strands.
Allele frequency here would be 0 (0/26) for reference allele, and 1.0 (26/26) for alternate allele.
xcrun: error: invalid active developer path (/Library/Developer/CommandLineTools), missing xcrun at: /Library/Developer/CommandLineTools/usr/bin/xcrun, you can't use your git after upgrading macOS
xcode-select --installThis will pop a dialogue box, Select "Install", and it will download and install the Command Line Tools package and fix the problem.
Edit the library.yaml file first, add the book name and STAR
Then
make cover
git add ..
git commit -n "n"
git push origin main
Neovim (and many other applications) doesn't touch your ~/.config/ directory per default. You just need to create the nvim directory
It's different from Vim, you need to:
mkdir -p ~/.config/nvim
nvim ~/.config/nvim/init.vim # Edit it
# For example, add: set mouse=vBecasue nvim sets your vim into visual mode whenever you select something with the mouse. And for some mad reason one is not allowed to copy when in visual mode. You can get around it by holding down shift when selecting text not to go into visual mode allowing you to use the copy menu.
Simply edit the ~/.config/nvim/init.vim and add:
set mouse=v
Done!
Github push error: fatal: Unable to create '/Users/qgn1237/Library/CloudStorage/OneDrive-NorthwesternUniversity/github_project/Computational-Medicine-and-Bioinformatics-Terminology-Database/.git/index.lock': File exists
The error message suggests that there is a lock file present, which typically means that another Git process is running or a previous Git process did not exit cleanly. To resolve the issue, follow these steps:
Make sure there are no other active Git processes running. Close any relevant terminal windows or Git applications that might be accessing the repository.
Remove the lock file manually. In your terminal, navigate to the repository's root directory and run the following command:
rm -f .git/index.lockpip install python-pptx
./extract_text_ppt.py 【20230413】qingxiang_guo_basic_seminar.pptx
# You can find it in the script directory- Filter the SVIM results
# A SVIM result looks like this:
GL000008.2 1524 svim.DEL.7 AGAATGGGATGGAATGGAATTGAATGATGTGGAGTGGAGTCGGGTGGAGTGGA A 2 PASS SVTYPE=DEL;END=1576;SVLEN=-52;SUPPORT=2;STD_SPAN=4.24;STD_POS=14.85 GT:DP:AD ./.:.:.,.
# Filtering the variant calls by QUAL, supporting reads, and PASS, we cannot make a general statement about suitable score cutoffs. # For high-coverage datasets (>40x), we would recommend a threshold of 10-15. For low-coverage datasets, the threshold should be lower.
# A good approach could also be to select a cutoff that returns the expected or desired number of calls. A recent study by the Human Genome Structural Variation Consortium (HGSVC), for instance, estimated the average number of deletions and insertions per individual to be 9,488 and 15,337, respectively (Chaisson et al., 2019)
bcftools filter -i 'QUAL >= 5 && FILTER == "PASS" && INFO/SUPPORT >= 2' input.vcf > output.vcf
This is a strict criteria that can filter 400,000 SVs to 2,000
So you should make trial & error- Filter the PBSV results
chr1 669597 pbsv.INS.DUP.0 A <DUP> . PASS SVTYPE=DUP;END=669679;SVLEN=82 GT:AD:DP:SAC 1/1:1,4:5:1,0,3,1
# PBSV will not have the SUPPORT reads option
bcftools filter -i 'FILTER == "PASS" && FORMAT/AD[0:1] >= 2' input.vcf > output.vcf
# When filtering SVs, the variants with high support can be filtered based on the threshold value of AD [1].
# The [0:1] means the 1 subfield of the 0 sample- Filter the Sniffles2 results
# Sniffles has already an automatic filter in the output.
# If you want to filter further, the easiest is to ignore the IMPRECISE marked calls
# Another thing would be to filter for the number of read supports
chr1 710590 Sniffles2.INS.14S0 N AAGAACTGCCTGCCGGGCGCGTGTGGCTCACGCCTTGTAATTCCCAGCACTTTGGGAGGCCGCAGGCGGGCCGGATCACGAGCGTCAGGAGATCGAGACCATCCCGGCTAAAACGGCTTTGAAAAAACCCCGTCTCTACTAAAAATTACAAAAAATTAGCCCCGTAGTGGCGGGCGCGTTTAGTCCCAGCTACTTTGCGGAGGCTGAGGCAGGAAGAATGGGCGTGAACCCGCGGAGGTGGAGCTTTGCAGTGAGCCTAAGATCCCACTCACTCCAGCCTGCGGCGACAGAGCCAGACTCGTCTCAAAAAAAAAAAAAAAAAAAAAAAAAAAA 31 PASS PRECISE;SVTYPE=INS;SVLEN=333;END=710590;SUPPORT=3;COVERAGE=2,3,3,3,3;STRAND=+-;AF=1.000;STDEV_LEN=18.502;STDEV_POS=6.083;SUPPORT_LONG=0 GT:GQ:DR:DV 1/1:8:0:3
# DV：Depth of variant-supporting bases
bcftools view -i 'INFO/SUPPORT >= 2 && INFO/IMPRECISE != 1' intput.vcf > output.vcf- Filter the CuteSV results
chrY 56833655 cuteSV.DEL.48873 TCCTATTCCATTCCTC T . PASS PRECISE;SVTYPE=DEL;SVLEN=-15;END=56833670;CIPOS=-1,1;CILEN=-0,0;RE=3;RNAMES=NULL;STRAND=+- GT:DR:DV:PL:GQ ./.:.:3:.,.,.:.
bcftools view -i 'FILTER == "PASS" && INFO/PRECISE == 1 && INFO/RE >= 2' input.vcf > output.vcf- Filter the DeBreak results
chrY 2464326 DB4000 TTCCCTAGCAATCCGGCCAAGGGCCGCTGATGTGCACACACTGAAGACGTTCCCTAAGTGTGTGGCTAAGGGACTGCTACCATATACACACTGAAGATGTTCCCTAAGAATGTGGGTAAGGGACCGCCGCCATGTTCGCACTGAAGACG N . PASS CHR2=chrY;SVLEN=149;SUPPREAD=4;MAPQ=0;SVMETHOD=DeBreak;PRECISE;SVTYPE=DEL GT 0/1
bcftools view -i 'FILTER == "PASS" && INFO/PRECISE == 1 && INFO/SUPPREAD >= 2' input.vcf > output.vcf- Filter the SVDSS results
chrX 147512934 DEL_chrX:147512934-147512961_28 TTGCAGTACAATACACATTGTATTACAC T . PASS VARTYPE=SV;SVTYPE=DEL;SVLEN=-28;END=147512961;WEIGHT=2;COV=4;AS=358;NV=1;CIGAR=33=28D46= GT 0/1
# You can filter the reported SVs by passing the --min-sv-length and --min-cluster-weight options. These options control the minimum length and minimum number of supporting superstrings for the reported SVs. Higher values for --min-cluster-weight will increase precision at the cost of reducing recall. For a diploid 30x coverage sample, --min-cluster-weight 2 produced the best results in our experiments. For a haploid 30x sample, instead, --min-cluster-weight 4 produced the best results.
bcftools view -i 'FILTER == "PASS" && INFO/NV >= 2' input.vcf > output.vcfIf BED start and end = 0 8, VCF start =1, end = 8 BED is 0-based coordinate system, VCF is 1-based
filter_vcf_based_on_length.py -i input.vcf -o length.vcf -l 50This guide aims to assist users facing a specific issue with the MinION Mk1C device. Users may experience problems after attempting to update the device's software version, causing the device to blackout, display a blue screen with various icons, or show an "Unknown" installed version.
Symptoms:
- After clicking on "Install Update" for a software version upgrade, the device blacks out for an extended period (e.g., over 16 hours).
- The device occasionally displays a blue screen with various icons, including menu icons, a mail icon, and the test flow cell icon. Despite prompts to swipe up to unlock, the device remains on the blue screen.
- After rebooting, the interface changes and the "MinKNOW Installed version" now shows "Unknown".
- In the Host Settings, the Network Settings option is missing, preventing the user from confirming the network connection status or obtaining the device's IP address.
- When attempting to run the “ssh minit@mc-XXXX” command, the system reports an error: “ssh: Could not resolve hostname mc-XXXX: nodename nor servname provided, or not known”.
- Attempting to restore using a previous SD card (with an earlier software version) does not resolve the issue.
Resolution:
Step 1: Preparing a USB drive
- Format a USB key as FAT or exFAT.
- Create a directory on the USB called
minit_config. - In the
minit_configdirectory, create two plain files (without file extensions):sshandaccess-point. These are command files that will enable SSH and put the device into hotspot mode.
Step 2: Enabling SSH and hotspot mode on the device
- Plug the USB drive into the powered-on Mk1C device. The white LEDs on the screen should stop scrolling and all flash red twice, indicating the script's activation.
- The device will execute the commands in the
minit_configfolder and capture some system configuration information. Once complete, the lights will flash green, indicating the process is complete and the drive can be safely removed.
Step 3: Connecting to the device
- Reboot the device.
- Connect to the device's hotspot using another device (e.g., a computer). The hotspot should have the same name as the Mk1C device (e.g., MC-1XXXX). The password is: WarmButterflyWings98
Step 4: Accessing the device via SSH
- SSH into the device using the following command:
ssh minit@10.42.0.1Note: If you have connected with other Mk1c deivce before, clean the key by :
ssh-keygen -R 10.42.0.1 and ssh again.
- Run the following command to get the device's IP address while connected to Ethernet:
ifconfig. The IP address is listed foreth0.
Step 5: Updating the device
If the device has an internet connection, run the following commands to update it:
sudo apt clean
sudo apt --fix-broken install
sudo shutdown -r now
Note:
This guide is based on a specific issue and might not apply to all problems encountered with the MinION Mk1C device. For different issues, please contact the Nanopore official technical support or check the Nanopore community forums for assistance.
While the MinION Mk1C software can generally be updated via the user interface, some scenarios require manual software updates. If you prefer to update through the command line or need feedback during updates, this guide is for you.
Please always refer to the release notes for any version-specific commands that may be supplied.
Prerequisites:
- Ensure that the MinION Mk1C is connected to a stable internet connection.
- Have SSH access to the MinION Mk1C.
Steps to Update Only the MinKNOW Software:
- Connect to the MinION Mk1C using SSH.
- Open a terminal window.
- Run the following commands one at a time to update the list of available software:
sudo apt clean
sudo apt update
sudo apt install ont-mk1c-release
These commands should complete successfully, without any errors or warnings.
- If you encounter any error or warning message, ensure that your MinION Mk1C is connected to the Internet. You can diagnose network connection problems by running the following command:
sudo /opt/ont/mooneye/bin/ont-mooneye-check-network --verbose --diagnose
- Once the commands have completed successfully without errors, reboot the device using the command:
sudo reboot
Steps to Update the Operating System and MinKNOW Software Simultaneously:
If you want to update both the operating system and MinKNOW software at the same time, follow these steps:
- Connect to the MinION Mk1C using SSH.
- Open a terminal window.
- Run the following commands one at a time:
export DEBIAN_FRONTEND=noninteractive
sudo apt upgrade
- Reboot the device using the command:
sudo reboot
Note: This will update all packages to their latest versions, so it may take longer than the MinKNOW-only update.
Remember to check the 'Current version' under software version number after the updates to ensure that your software has been updated successfully.
Before starting, ensure that you have the following installed:
- Latest version of Neovim (v0.9.0+)
- Git
- Make
- Pip
- Python
- NPM
- Node.js
- Cargo
-
Enter your mamba environment:
ma
-
Execute the LunarVim installation script using bash:
env LV_BRANCH='release-1.3/neovim-0.9' bash -c "bash <(curl -s https://raw.githubusercontent.com/LunarVim/LunarVim/release-1.3/neovim-0.9/utils/installer/install.sh)"
During this step, you may encounter an error related to the compilation of
nvim-treesitter[python]. This occurs when thecc1pluscompiler is not found.if you are neovim with > 10 version,use:
bash <(curl -s https://raw.githubusercontent.com/lunarvim/lunarvim/master/utils/installer/install.sh) -
To resolve this issue, you can install a C++ compiler within your Mamba environment using the following command:
mamba install -c conda-forge cxx-compiler
-
Afterwards, set the
CXXenvironment variable to point to your environment'sg++:export CXX=$CONDA_PREFIX/bin/g++
set -U fish_user_paths $fish_user_paths ~/.local/bin/ . # Set the environmental variable
make sure to manually run ':Lazy sync' when starting lvim for the first time.This guide shows how to install and use the Dracula theme in LunarVim. Similar steps can be followed for other plugins.
First, you need to open your LunarVim configuration file. You can do this with the following command:
nvim ~/.config/lvim/config.luaIn the configuration file, locate the lvim.plugins section. Here you add the plugin information. For example, to add the Dracula theme, you can use:
lvim.plugins = {
{
"Mofiqul/dracula.nvim",
},
-- more plugins can go here
}Next, set your chosen theme. For Dracula, you can use:
lvim.colorscheme = "dracula"Save and exit the file.
cargo install --locked zellij
zellij setup --dump-config > ~/.config/zellij/config.kdl # Create config file
zellij options --theme dracula # change theme
ctrl + O and d to leave the session, zellij a to attach a session, zellij -s to create a new session
zellij action close-pane # Close the current pane.Accelerating Your Command Line Operations using Zellij and SLURM (original by yangyang Li, https://yangyangli.top/)
This tutorial will guide you through the steps to expedite your command line operations on a compute node from a login node, using zellij to maintain an interactive srun session in a SLURM-managed cluster. This process can greatly improve your command execution speed, especially if your login node is heavily loaded.
- Basic understanding of command line interface (CLI)
- Access to a SLURM-managed cluster
zellijandsruncommand line tools installed
To begin, open your command line interface and start a new Zellij session by typing:
zellij -s qThe -s q option gives a name (in this case, "q") to your Zellij session.
You can verify the node you're currently on by executing the hostname command:
hostnameThis command will return the name of the node you're currently logged into. At this point, you should be on the login node.
Next, you can start an interactive srun session with specified resources. This command will move you from the login node to a compute node, enhancing your command execution speed:
srun -n 12 -p b1171 --account=b1171 -t 10:00:00 --mem 16g --pty bashIn this example, -n 12 specifies the number of CPUs, -p b1171 specifies the partition, --account=b1171 specifies the account, -t 10:00:00 specifies the time limit, and --mem 16g specifies the amount of memory.
Once the srun session starts, you can verify that you're on a compute node by running the hostname command again.
When you're done with your tasks on the compute node, you can detach from the Zellij session without ending the srun session by using the shortcut Ctrl + o, followed by d.
This tutorial walked you through the process of using Zellij and srun to expedite your command line operations on a compute node. Remember, when you exit Zellij, any tasks running within the srun session will continue to run until they're completed or until the time limit is reached. Thus, you can significantly improve your productivity by leveraging the computational power of the compute nodes.
Of course! Here's a markdown-formatted guide to solve the problem you described:
If you're experiencing issues with SSH and name resolution within the Windows Subsystem for Linux (WSL) Ubuntu system, the following steps can help you address it.
- Failed SSH attempts due to "failure in name resolution."
- Using
pingresults in an error, e.g.,ping: quest.northwestern.edu temporary failure in name resolution. - Accessing websites via a browser on Windows works without issues.
WSL can automatically generate the resolv.conf file, which may cause DNS resolution problems. To prevent WSL from auto-generating this file:
- Open WSL terminal.
- Create or edit the
wsl.conffile by typing:sudo vim /etc/wsl.conf - Add the following content to the file:
[network] generateResolvConf = false - Save the file and exit.
You'll need to manually set up the DNS configuration in the resolv.conf file:
-
Still within the WSL terminal, create a new
resolv.conffile:sudo vim /etc/resolv.conf -
Add the following content:
# This file was automatically generated by WSL. To stop automatic generation of this file,
# add the following entry to /etc/wsl.conf:
# [network]
# generateResolvConf = false
# nameserver 172.23.0.1
nameserver 8.8.8.8
- Save the file and exit.
After performing the above steps, test the solution:
- In the WSL terminal, try pinging a known website:
ping google.com
This guide provides a quick walkthrough on how to visualize the trade-off between precision and recall using the provided Python script.
-
Prepare Your Data:
The script uses predefined data. If you want to use your own data, modify the
prsarray inside the script:prs = np.array([ [precision1, recall1], [precision2, recall2], ... ]) labels = ["Label 1", "Label 2", ...]
-
Run the Script:
Navigate to the script's directory and execute:
python precision-recall-diagrams.py
Pip Install
- Tool: Standard package installer for Python.
- Use Case: Used by end-users for installing Python packages from PyPI or other sources.
- Focus: Manages the installation of individual packages without handling project-wide dependencies.
Poetry Install
- Tool: Modern Python dependency management and packaging tool.
- Use Case: Suited for developers managing dependencies of entire projects.
- Functionality: Installs all dependencies based on
pyproject.tomland may create virtual environments for isolation. - Advantages: Manages project dependencies, ensuring consistent development environments.
- Both
pipandpoetryinstall command line tools of packages toScripts(Windows) orbin(Unix-like systems) in the Python environment. - These directories are typically included in the system's PATH, allowing command line recognition and execution of these tools.
- Mechanism: Allows packages to specify one or more command line script entry points.
- Implementation: Scripts created during package installation, placed in executable directories.
- Configuration:
setup.pyfor pip:entry_points={'console_scripts': ['mycommand = mypackage.mymodule:main_func']}pyproject.tomlfor poetry:[tool.poetry.scripts] mycommand = 'mypackage.mymodule:main_func'
- Function: These scripts are lightweight wrappers calling functions or classes in the package.
poetry installenhances Python's environment by managing and installing a project's packages and dependencies, updating module paths (sys.path), and setting up command line tools. This process ensures that packages and their dependencies are accessible and functional in the specified Python environment.
- Dependency Resolution: Reads
pyproject.tomlto determine required packages and versions. - Virtual Environment: Installs packages in the active or a new virtual environment.
- Package Installation: Downloads and installs packages from PyPI or other sources into the Python environment.
- Module Path Update: Adds installed packages' paths to Python's
sys.path. - Entry Point Setup: Creates scripts for command line tools as defined in
pyproject.toml. - Dependency Locking: Updates
poetry.lockto ensure consistent versions across environments.
- Python Path (
sys.path): A list where Python looks for modules to import. - Site-packages Directory: Common location for installed packages (e.g.,
/Users/qgn1237/mambaforge/envs/test_octopusv/lib/python3.9/site-packages).
- Executable Scripts: Located in
binorScriptsdirectory of the Python environment. - Example Script Path:
/Users/qgn1237/mambaforge/envs/test_octopusv/bin/octopusv. - Import Logic in Scripts: Can successfully import modules (e.g.,
from octopusv.cli.cli import app) due to their presence in thesite-packagesdirectory.
octopusvPackage: Typically found in thesite-packagesdirectory.- Metadata Directory (
octopusv-0.1.0.dist-info): Contains metadata likedirect_url.json,entry_points.txt,INSTALLER,METADATA, andRECORD.
This tutorial explains how to automate your software testing process using Nox, Pytest, and GitHub Actions.
Create a noxfile.py with sessions for different Python versions:
import nox
@nox.session(python="3.9")
def tests_39(session):
session.run("poetry", "install", external=True)
session.run("pytest", "--cov", "--cov-report=html")
@nox.session(python="3.10")
def tests_310(session):
session.run("poetry", "install", external=True)
session.run("pytest", "--cov", "--cov-report=html")Create a tests folder with your test cases. Here's an example test script:
import subprocess
import filecmp
import pytest
import os
# The test dir
TEST_DATA_DIR = "tests/data/VCF_for_testing_correct"
OUTPUT_DIR = "tests/output"
os.makedirs(OUTPUT_DIR, exist_ok=True)
def run_octopusv(input_file, output_file):
"""
Run octopusv.
"""
cmd = f"octopusv correct {input_file} {output_file}"
subprocess.run(cmd, shell=True, check=True)
def test_mate_bnd_independent():
input_vcf = os.path.join(TEST_DATA_DIR, "test_mate_bnd_independent.vcf")
output_vcf = os.path.join(OUTPUT_DIR, "output_mate_bnd_independent.vcf")
expected_output_vcf = os.path.join(TEST_DATA_DIR, "example_mate_bnd_independent.vcf")
run_octopusv(input_vcf, output_vcf)
# Compare output and expected file
assert filecmp.cmp(output_vcf, expected_output_vcf)Create a workflow file in .github/workflows/tests.yml. This file defines the CI pipeline.
name: Tests
on:
push:
branches:
- main
paths:
- "**.py"
- "**/Dockerfile"
- ".github/workflows/*.yml"
- poetry.lock
- pyproject.toml
pull_request:
branches:
- main
paths:
- "**.py"
- "**/Dockerfile"
- ".github/workflows/*.yml"
- poetry.lock
- pyproject.toml
jobs:
tests:
name: ${{ matrix.session }} ${{ matrix.python }} / ${{ matrix.os }}
runs-on: ${{ matrix.os }}
strategy:
fail-fast: false
matrix:
include:
- { python: "3.10", os: "ubuntu-latest", session: "pre-commit" }
- { python: "3.10", os: "ubuntu-latest", session: "safety" }
- { python: "3.10", os: "ubuntu-latest", session: "mypy" }
- { python: "3.9", os: "ubuntu-latest", session: "mypy" }
- { python: "3.10", os: "ubuntu-latest", session: "tests" }
- { python: "3.9", os: "ubuntu-latest", session: "tests" }
- { python: "3.10", os: "macos-latest", session: "tests" }
- { python: "3.9", os: "macos-latest", session: "tests" }
- { python: "3.10", os: "ubuntu-latest", session: "docs-build" }
env:
NOXSESSION: ${{ matrix.session }}
FORCE_COLOR: "1"
PRE_COMMIT_COLOR: "always"
steps:
- name: Check out the repository
uses: actions/checkout@v4
with:
fetch-depth: 1
- name: Cache pip packages
uses: actions/cache@v3
with:
path: ~/.cache/pip
key: ${{ runner.os }}-pip-${{ matrix.python }}-${{ hashFiles('**/requirements.txt') }}
restore-keys: |
${{ runner.os }}-pip-${{ matrix.python }}-
${{ runner.os }}-pip-
- name: Cache Poetry virtual environment
uses: actions/cache@v3
with:
path: .venv
key: ${{ runner.os }}-poetry-${{ matrix.python }}-${{ hashFiles('pyproject.toml') }}
restore-keys: |
${{ runner.os }}-poetry-${{ matrix.python }}-
${{ runner.os }}-poetry-
- name: Set up Python ${{ matrix.python }}
uses: actions/setup-python@v4
with:
python-version: ${{ matrix.python }}
- name: Upgrade pip
run: |
pip install --constraint=.github/workflows/constraints.txt pip
pip --version
- name: Upgrade pip in virtual environments
shell: python
run: |
import os
import pip
with open(os.environ["GITHUB_ENV"], mode="a") as io:
print(f"VIRTUALENV_PIP={pip.__version__}", file=io)
- name: Install Dependencies
if: matrix.os == 'ubuntu-latest'
run: |
sudo apt-get update
sudo apt-get install -q --no-install-recommends --no-install-suggests libhts-dev libssl-dev
- name: Cache macOS dependencies
if: matrix.os == 'macos-latest'
uses: actions/cache@v3
with:
path: ~/brew-cache
key: macos-brew-${{ hashFiles('**/Dockerfile') }}
restore-keys: |
macos-brew-
- name: Configure Homebrew
if: matrix.os == 'macos-latest'
uses: Homebrew/actions/setup-homebrew@master
- name: Install Dependencies
if: matrix.os == 'macos-latest'
env:
HOMEBREW_NO_AUTO_UPDATE: 1
HOMEBREW_NO_INSTALL_CLEANUP: 1 # Do not run brew cleanup automatically.
HOMEBREW_NO_INSTALLED_DEPENDENTS_CHECK: 1 # Do not automatically update packages.
run: |
brew install htslib
brew install openssl@3
ln -sf $(brew --prefix openssl)/include/openssl /usr/local/include/openssl
ln -sf $(brew --prefix openssl)/lib/*a /usr/local/lib/
ln -sf $(brew --prefix openssl)/lib/*dylib /usr/local/lib/
- name: Install Poetry
run: |
pipx install --pip-args=--constraint=.github/workflows/constraints.txt poetry
poetry --version
- name: debug
if: matrix.os == 'macos-latest'
run: |
which python
- name: Install Nox
run: |
pipx install --pip-args=--constraint=.github/workflows/constraints.txt nox
pipx inject --pip-args=--constraint=.github/workflows/constraints.txt nox nox-poetry
nox --version
- name: Compute pre-commit cache key
if: matrix.session == 'pre-commit'
id: pre-commit-cache
shell: python
run: |
import hashlib
import sys
python = "py{}.{}".format(*sys.version_info[:2])
payload = sys.version.encode() + sys.executable.encode()
digest = hashlib.sha256(payload).hexdigest()
result = "${{ runner.os }}-{}-{}-pre-commit".format(python, digest[:8])
print("::set-output name=result::{}".format(result))
- name: Restore pre-commit cache
uses: actions/cache@v3
if: matrix.session == 'pre-commit'
with:
path: ~/.cache/pre-commit
key: ${{ steps.pre-commit-cache.outputs.result }}-${{ hashFiles('.pre-commit-config.yaml') }}
restore-keys: |
${{ steps.pre-commit-cache.outputs.result }}-
- name: Run Nox for Python 3.9 tests session
if: matrix.session == 'tests' && matrix.python == '3.9'
run: nox --session tests_39 --force-color
- name: Run Nox for Python 3.10 tests session
if: matrix.session == 'tests' && matrix.python == '3.10'
run: nox --session tests_310 --force-color
- name: Upload coverage data
if: always() && matrix.session == 'tests'
uses: "actions/upload-artifact@v3"
with:
name: coverage-data-${{ matrix.python }}-${{ matrix.os }}
path: "htmlcov/index.html"
- name: Upload documentation
if: matrix.session == 'docs-build'
uses: actions/upload-artifact@v3
with:
name: docs
path: docs/_build-
Triggering GitHub Actions:
- Defined in
.github/workflows/tests.yml. - Triggered on push or pull request to the main branch.
- Monitors changes in Python files, Dockerfiles, workflow files, and dependency lock files.
- Defined in
-
Running Nox Sessions via GitHub Actions:
- GitHub Actions uses the
noxcommand, as specified innoxfile.py. - Runs different Python versions (3.9, 3.10) using separate Nox sessions (
tests_39,tests_310).
- GitHub Actions uses the
-
Nox Session Execution:
- Installs dependencies via
poetry. - Executes Pytest with coverage options:
session.run("pytest", "--cov", "--cov-report=html").
- Installs dependencies via
-
Pytest Testing Process:
- Located in the
/testsdirectory. - Test scripts like
test_correct_end_to_end.pyare run. - Tests compare the output of
octopusvcommands with expected results usingfilecmp.cmp.
- Located in the
-
Coverage Report Generation and Upload:
- Pytest generates an HTML coverage report.
- GitHub Actions uploads this report as an artifact for review.
This setup forms a comprehensive CI/CD pipeline, ensuring that each code change is automatically tested for reliability and coverage.
Absolutely, your understanding is correct. Here's a simple Markdown tutorial in English to guide you through the process of working with Overleaf and GitHub without direct integration:
This guide will help you maintain a LaTeX project on Overleaf and synchronize it with a GitHub repository.
- Create a repository on GitHub for your LaTeX project.
- Clone the repository to your local machine using
git clone <repository-url>. - Create your LaTeX project on Overleaf and begin your writing.
- Edit your document on Overleaf as usual.
- Download the project from Overleaf by clicking on
Menuand selectingSourceunderDownload.
- Extract the downloaded ZIP file to your local repository folder.
- Open your terminal or command prompt and navigate to your repository folder.
- Run the following commands to update your GitHub repository:
git status # Check the changed files git add . # Add all changes to git git commit -m "Description of the changes" # Commit changes git push # Push changes to GitHub
- Before you start a new session, pull the latest version from GitHub:
git pull # Update your local repository - Upload the updated files to Overleaf:
- Go to your Overleaf project.
- Click on
Menuand underUploadselectZIPto upload your local repository files.
- Inform your collaborators to pull from GitHub before they start editing.
- After they have made changes, they should also push their updates to GitHub.
- Always communicate with your team when you push or pull changes to avoid conflicts.
- Commit frequently with clear, descriptive messages.
- Pull from GitHub before you start working to get the latest version.
- Push to GitHub after each significant change or at the end of your working session.
- Use
.gitignoreto exclude files that don't need to be version controlled (e.g.,.aux,.logfiles).
By following these steps, you can ensure that your LaTeX project is well-maintained and up-to-date across both Overleaf and GitHub.
Remember to replace <repository-url> with the actual URL of your GitHub repository. This guide assumes a basic knowledge of git commands and the functionality of Overleaf. If you or your collaborators are not familiar with git, you may need a more detailed tutorial on git usage.
cmp --silent sim.srt.bam visor.ba || echo "files are different"