Edited rna example to include indels, which prints out U nucleotides

examples/rna.dawg

@@ -1,15 +1,28 @@
 # Test rna evaluationary models
 
 Output.Rna = 1
+Output.lowercase = 1
+Output.markins = 1
+Output.keepempty = 1
 Tree.Tree = "(A:0.3, B:0.2)C;"
 Tree.Scale = 0.99999
 Root.Length = 100
 Root.Code = 2
-Root.Seq = "AATGCTTTTTTTTTTGGCCAA"
+Root.Seq = "AATGCTTTTTTTAAGCAAATGGCCAA"
 Sim.Reps = 4
 Sim.Seed = 42
 Root.Seg = 0
 
+[Indel]
+Params.Ins = 1.039000, 50
+Model.Ins = "GEO"
+Rate.Ins = 0.01
+Max.Ins = 50.0
+Params.Del = 1.039000, 50
+Model.Del = "POWER-LAW"
+Rate.Del = 0.01
+Max.Del = 50.0
+
 Subst.Model = "gtr"
 Subst.Freqs  = 0.2, 0.3, 0.3, 0.2
 Subst.Params = 2.0, 1.0, 3.0, 1.0, 1.0, 1.0

src/include/dawg/residue.h

@@ -110,14 +110,18 @@ class residue_exchange {
 
 	explicit residue_exchange(int m=DNA) { model(m,0,0,false,false,false); }
 
+	template <typename F, typename L>
+	void echo(F f, L l) const {
+		std::cout << "File: " << f << ", Line: " << l <<
+		", type: " << type_ << 
+		", code: " << code_ << ", rna: " << rna_ << ", lowercase: " <<
+		lowercase_ << ", markins: " << markins_ << ", keepempty: " << keepempty_ <<
+		", nuc: " << nuc_ << std::endl;
+	}
+
 	inline bool model(unsigned int type, unsigned int code, bool rna,
 			bool lowercase, bool markins, bool keepempty) {
 
-		std::cout << "type: " << type << 
-		", code: " << code << ", rna: " << rna << ", lowercase: " <<
-		lowercase << ", markins: " << markins << ", keepempty: " << keepempty << std::endl;
-
-
 		static constexpr char sIns[] = "-+";
 		// table for going from base->char
 		// TODO: Allow codons to be translated into aa
@@ -171,14 +175,18 @@ class residue_exchange {
 			39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,-1,-1,-1,-1,-1
 		};
 
+		echo(__FILE__, __LINE__);
+
 		markins_ = markins;
 		keepempty_ = keepempty;
 		lowercase_ = lowercase;
 		rna_ = rna;
 		type_ = type; // set sequence type DNA, AA, or CODON
 		nuc_ = ((rna) ? MODRNA : MODDNA) | static_cast<unsigned int>((lowercase) ? 1 : 0);
 		code_ = code;
-
+
+		echo(__FILE__, __LINE__);
+
 		if(MODCOD+code_ >= MODEND || mods[(MODCOD+code_)*64] == '!')
 			return DAWG_ERROR("invalid genetic code.");