ryneches/raygun
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Folders and files
Name | Name | Last commit message | Last commit date | |
---|---|---|---|---|
Repository files navigation
I got very tired of invoking formatdb and blastall from the command line and parsing the results. So I wrote this very simple wrapper to do it. This is not intended to be an efficient way of using BLAST. It's dumb but quick. It's point-and-shoot, like a raygun should be. INSPIRATIONAL QUOTE ------------------- It's a poor blaster that doesn't point both ways. - Isaac Asimov INSTALLING ---------- Do the usual python thing. $ cd raygun $ python setup.py install --prefix=/someplace/PYTHONPATH/knows/about TESTS ----- Tests are designed to be used with nose. http://somethingaboutorange.com/mrl/projects/nose/ The tests (stupidly) depend on hard-coded paths to find the test data files, so you have to run nosetests from the main module directory (i.e., the one that has setup.py in it). $ cd raygun $ nosetests USAGE ----- import raygun import cleverness rg = raygun.RayGun( 'ZOMG_DNA_OMG_OMG.fa' ) hits = rg.blastfile( 'very_clever_query.fa' ) results = [] for hit in hits : results.append( cleverness.function_of_amazingness( hit[ 'subject' ] ) ) hits = rg.blastseq( 'aaaggtttttagtccatcgacccta' ) for hit in hits : results.append( cleverness.gee_wiz( hit[ 'length' ] ) ) cleverness.output_phd_thesis( results ) FIELDS ------ These are the dictionary keys for each hit result returned. query : query record identifier subject : subject record identifier percent_id : percent identity length : alignment length missmatches : number of mismatches gaps : number of gaps qstart : query sequence alignment start coordinate qend : query sequence alignemnt end coordinate sstart : subject sequence alignment start coordinate send : subject sequence alingment end coordinate e : e-value bit : bit score LEGAL STUFF ----------- Copyright (c) 2010, Russell Neches All rights reserved. Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions are met: * Redistributions of source code must retain the above copyright notice, this list of conditions and the following disclaimer. * Redistributions in binary form must reproduce the above copyright notice, this list of conditions and the following disclaimer in the documentation and/or other materials provided with the distribution. * Neither the name of the University of California, Davis nor the names of its contributors may be used to endorse or promote products derived from this software without specific prior written permission. THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT HOLDER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
About
A simple python wrapper for NCBI BLAST.
Resources
Stars
Watchers
Forks
Releases
No releases published
Packages 0
No packages published