Can't find exonDelsCutoffs.csv #4

pineapple216 · 2015-04-16T11:04:06Z

Dear Shilin,

Thanks for the update to 1.02, it has fixed the dependency problem for I which opened an issue earlier.
When I tried to run ExonDel today on my data It gave the following output message:

[Thu Apr 16 10:49:46 2015] Thread 1 finished
[Thu Apr 16 10:49:47 2015] Thread 2 finished
[Thu Apr 16 10:49:47 2015] Thread 3 finished
[Thu Apr 16 10:49:47 2015] Thread 4 finished
[Thu Apr 16 10:49:47 2015] Thread 5 finished
[Thu Apr 16 10:49:47 2015] Thread 6 finished
[Thu Apr 16 10:49:47 2015] Finish bam file
[Thu Apr 16 10:49:47 2015] Analyzing Exon Deletion
can't find /home/koen/cnv_tool_comparison/ExonDel_results/exonDelsCutoffs.csv

ExonDel.log is empty and ExonDel.rLog contains the following:

Can't find any exon deletions with 1 windows length
Can't find any exon deletions with 2 windows length
Can't find any exon deletions with 3 windows length
Can't find any exon deletions with 4 windows length
Can't find any exon deletions with 5 windows length
Can't find any exon deletions with 6 windows length
Can't find any exon deletions with 7 windows length
Can't find any exon deletions with 8 windows length
Can't find any exon deletions with 9 windows length

Hopefully you can help me resolve this issue.

Thanks!

Koen

slzhao · 2015-04-16T20:53:41Z

Hi Koen,

it seems that ExonDel can't find any exon deletion in your bam file. Did
you try the example file provided by ExonDel? Can you get any result from
example file?

Best,
Shilin

2015-04-16 6:04 GMT-05:00 Koen Hendriks notifications@github.com:

Dear Shilin,

Thanks for the update to 1.02, it has fixed the dependency problem for I
which opened an issue earlier.
When I tried to run ExonDel today on my data It gave the following output
message:

[Thu Apr 16 10:49:46 2015] Thread 1 finished
[Thu Apr 16 10:49:47 2015] Thread 2 finished
[Thu Apr 16 10:49:47 2015] Thread 3 finished
[Thu Apr 16 10:49:47 2015] Thread 4 finished
[Thu Apr 16 10:49:47 2015] Thread 5 finished
[Thu Apr 16 10:49:47 2015] Thread 6 finished
[Thu Apr 16 10:49:47 2015] Finish bam file
[Thu Apr 16 10:49:47 2015] Analyzing Exon Deletion
can't find
/home/koen/cnv_tool_comparison/ExonDel_results/exonDelsCutoffs.csv

ExonDel.log is empty and ExonDel.rLog contains the following:

Can't find any exon deletions with 1 windows length
Can't find any exon deletions with 2 windows length
Can't find any exon deletions with 3 windows length
Can't find any exon deletions with 4 windows length
Can't find any exon deletions with 5 windows length
Can't find any exon deletions with 6 windows length
Can't find any exon deletions with 7 windows length
Can't find any exon deletions with 8 windows length
Can't find any exon deletions with 9 windows length

Hopefully you can help me resolve this issue.

Thanks!

Koen

—
Reply to this email directly or view it on GitHub
#4.

pineapple216 · 2015-04-22T11:12:41Z

Hi Shilin,

When I run ExonDel on the example data I get the following output:

[Wed Apr 22 13:06:05 2015] All genes will be used
[Wed Apr 22 13:06:05 2015] Loading BED file
[Wed Apr 22 13:06:05 2015] Finish BED file (cover 18683 base pairs)
[Wed Apr 22 13:06:05 2015] Loading RefSeq file
[Wed Apr 22 13:06:05 2015] Finish RefSeq file
[Wed Apr 22 13:06:05 2015] Loading fasta file and caculating GC content
[Wed Apr 22 13:06:08 2015] Caculating GC content in 5: 43 exons
[Wed Apr 22 13:06:10 2015] Caculating GC content in 6: 24 exons
[Wed Apr 22 13:06:11 2015] Caculating GC content in 13: 35 exons
[Wed Apr 22 13:06:11 2015] Finish fasta file
[Wed Apr 22 13:06:11 2015] Loading genesPassQCwithGC.bed
[Wed Apr 22 13:06:11 2015] Processing bam files
[Wed Apr 22 13:06:11 2015] example1.bam doesn't exist
[Wed Apr 22 13:06:11 2015] example2.bam doesn't exist
[Wed Apr 22 13:06:11 2015] example3.bam doesn't exist
[Wed Apr 22 13:06:11 2015] example4.bam doesn't exist
[Wed Apr 22 13:06:11 2015] Thread 1 stared
[Wed Apr 22 13:06:11 2015] Thread 2 stared
[Wed Apr 22 13:06:11 2015] Thread 3 stared
[Wed Apr 22 13:06:11 2015] Thread 4 stared
[Wed Apr 22 13:06:11 2015] Thread 1 finished
[Wed Apr 22 13:06:11 2015] Thread 2 finished
[Wed Apr 22 13:06:11 2015] Thread 3 finished
[Wed Apr 22 13:06:11 2015] Thread 4 finished
[Wed Apr 22 13:06:11 2015] Finish bam file
[Wed Apr 22 13:06:11 2015] Analyzing Exon Deletion
[Wed Apr 22 13:06:12 2015] Something wrong in running R. Please check the ExonDel.rLog file!

The rLog file contains the following:

Error in read.table(file = file, header = header, sep = sep, quote = quote, :
no lines available in input
Calls: read.bigFile -> read.delim -> read.table

genesPassQCwithGC.bed.depth is empty and genesPassWCwithGC.bed starts with:

5 118407083 118407351 DMXL1 NM_005509 0.70
5 118433673 118433799 DMXL1 NM_005509 0.40
5 118437629 118437701 DMXL1 NM_005509 0.33
5 118440874 118440953 DMXL1 NM_005509 0.39
5 118445845 118445978 DMXL1 NM_005509 0.37
5 118450169 118450236 DMXL1 NM_005509 0.40
5 118451852 118452031 DMXL1 NM_005509 0.40
5 118454509 118454699 DMXL1 NM_005509 0.36
5 118456665 118456834 DMXL1 NM_005509 0.48
5 118464905 118465118 DMXL1 NM_005509 0.36

No figures folder is created.

Kind regards,

Koen

slzhao · 2015-04-24T04:22:26Z

Hi Koen,

I think the example is not run correctly as it reported "example1.bam
doesn't exist".
After downloading the example files (for example, the example were
downloaded to "exampleDir"), you need use following command to run it:

cd exampleDir
perl path_to/ExonDel/ExonDel.pl -i exampleBams.list -c
ExonDel.example.cfg -o ./result1

Please let me know if you can run the example with it.

Best,
Shilin

2015-04-22 6:12 GMT-05:00 Koen Hendriks notifications@github.com:

Hi Shilin,

When I run ExonDel on the example data I get the following output:

[Wed Apr 22 13:06:05 2015] All genes will be used
[Wed Apr 22 13:06:05 2015] Loading BED file
[Wed Apr 22 13:06:05 2015] Finish BED file (cover 18683 base pairs)
[Wed Apr 22 13:06:05 2015] Loading RefSeq file
[Wed Apr 22 13:06:05 2015] Finish RefSeq file
[Wed Apr 22 13:06:05 2015] Loading fasta file and caculating GC content
[Wed Apr 22 13:06:08 2015] Caculating GC content in 5: 43 exons
[Wed Apr 22 13:06:10 2015] Caculating GC content in 6: 24 exons
[Wed Apr 22 13:06:11 2015] Caculating GC content in 13: 35 exons
[Wed Apr 22 13:06:11 2015] Finish fasta file
[Wed Apr 22 13:06:11 2015] Loading genesPassQCwithGC.bed
[Wed Apr 22 13:06:11 2015] Processing bam files
[Wed Apr 22 13:06:11 2015] example1.bam doesn't exist
[Wed Apr 22 13:06:11 2015] example2.bam doesn't exist
[Wed Apr 22 13:06:11 2015] example3.bam doesn't exist
[Wed Apr 22 13:06:11 2015] example4.bam doesn't exist
[Wed Apr 22 13:06:11 2015] Thread 1 stared
[Wed Apr 22 13:06:11 2015] Thread 2 stared
[Wed Apr 22 13:06:11 2015] Thread 3 stared
[Wed Apr 22 13:06:11 2015] Thread 4 stared
[Wed Apr 22 13:06:11 2015] Thread 1 finished
[Wed Apr 22 13:06:11 2015] Thread 2 finished
[Wed Apr 22 13:06:11 2015] Thread 3 finished
[Wed Apr 22 13:06:11 2015] Thread 4 finished
[Wed Apr 22 13:06:11 2015] Finish bam file
[Wed Apr 22 13:06:11 2015] Analyzing Exon Deletion
[Wed Apr 22 13:06:12 2015] Something wrong in running R. Please check the
ExonDel.rLog file!

The rLog file contains the following:

Error in read.table(file = file, header = header, sep = sep, quote =
quote, :
no lines available in input
Calls: read.bigFile -> read.delim -> read.table

genesPassQCwithGC.bed.depth is empty and genesPassWCwithGC.bed starts with:

5 118407083 118407351 DMXL1 NM_005509 0.70
5 118433673 118433799 DMXL1 NM_005509 0.40
5 118437629 118437701 DMXL1 NM_005509 0.33
5 118440874 118440953 DMXL1 NM_005509 0.39
5 118445845 118445978 DMXL1 NM_005509 0.37
5 118450169 118450236 DMXL1 NM_005509 0.40
5 118451852 118452031 DMXL1 NM_005509 0.40
5 118454509 118454699 DMXL1 NM_005509 0.36
5 118456665 118456834 DMXL1 NM_005509 0.48
5 118464905 118465118 DMXL1 NM_005509 0.36

No figures folder is created.

Kind regards,

Koen

—
Reply to this email directly or view it on GitHub
#4 (comment).

pineapple216 · 2015-04-28T09:23:00Z

Hi Shilin,

You were right. I didn't had the paths set in the exampleBams.list file.
I tried running ExonDel again and it seems to be working.

Both the normal log file and the rLog file are empty

It however gives an error regarding to the report generation, as can be seen in the output below.

/home/koen/cnv_tool_comparison/ExonDel_example/results/
[Tue Apr 28 11:10:37 2015] All genes will be used
[Tue Apr 28 11:10:37 2015] Loading BED file
[Tue Apr 28 11:10:37 2015] Finish BED file (cover 18683 base pairs)
[Tue Apr 28 11:10:37 2015] Loading RefSeq file
[Tue Apr 28 11:10:38 2015] Finish RefSeq file
[Tue Apr 28 11:10:38 2015] Loading fasta file and caculating GC content
[Tue Apr 28 11:10:40 2015] Caculating GC content in 5: 43 exons
[Tue Apr 28 11:10:42 2015] Caculating GC content in 6: 24 exons
[Tue Apr 28 11:10:43 2015] Caculating GC content in 13: 35 exons
[Tue Apr 28 11:10:43 2015] Finish fasta file
[Tue Apr 28 11:10:43 2015] Loading genesPassQCwithGC.bed
[Tue Apr 28 11:10:43 2015] Processing bam files
[Tue Apr 28 11:10:43 2015] Thread 1 stared
[Tue Apr 28 11:10:43 2015] Thread 1 processing /home/koen/cnv_tool_comparison/ExonDel_example/example1.bam example1
[Tue Apr 28 11:10:43 2015] Thread 1 processing /home/koen/cnv_tool_comparison/ExonDel_example/example2.bam example2
[Tue Apr 28 11:10:43 2015] Thread 1 processing /home/koen/cnv_tool_comparison/ExonDel_example/example3.bam example3
[Tue Apr 28 11:10:43 2015] Thread 2 stared
[Tue Apr 28 11:10:43 2015] Thread 2 processing /home/koen/cnv_tool_comparison/ExonDel_example/example4.bam example4
[Tue Apr 28 11:10:44 2015] Thread 3 stared
[Tue Apr 28 11:10:44 2015] Thread 4 stared
[Tue Apr 28 11:10:44 2015] Thread 1 finished
[Tue Apr 28 11:10:44 2015] Thread 2 finished
[Tue Apr 28 11:10:44 2015] Thread 3 finished
[Tue Apr 28 11:10:44 2015] Thread 4 finished
[Tue Apr 28 11:10:44 2015] Finish bam file
[Tue Apr 28 11:10:44 2015] Analyzing Exon Deletion
can't open ./report_tmpl.tmpl! at /net/clusterhn.cluster.com/home/koen/cnv_tool_comparison/ExonDel/Report/Generate.pm line 30.

(I ran test.modules and it reports that all modules are installed correctly).

Please let me know if you need more information and/or log files.

Bests,

Koen

slzhao · 2015-04-29T04:10:56Z

Hello Koen,

I've updated the code in github and it will work now.

Best,
Shilin

2015-04-28 4:23 GMT-05:00 Koen Hendriks notifications@github.com:

Hi Shilin,

You were right. I didn't had the paths set in the exampleBams.list file.
I tried running ExonDel again and it seems to be working.

Both the normal log file and the rLog file are empty

It however gives an error regarding to the report generation, as can be
seen in the output below.

/home/koen/cnv_tool_comparison/ExonDel_example/results/
[Tue Apr 28 11:10:37 2015] All genes will be used
[Tue Apr 28 11:10:37 2015] Loading BED file
[Tue Apr 28 11:10:37 2015] Finish BED file (cover 18683 base pairs)
[Tue Apr 28 11:10:37 2015] Loading RefSeq file
[Tue Apr 28 11:10:38 2015] Finish RefSeq file
[Tue Apr 28 11:10:38 2015] Loading fasta file and caculating GC content
[Tue Apr 28 11:10:40 2015] Caculating GC content in 5: 43 exons
[Tue Apr 28 11:10:42 2015] Caculating GC content in 6: 24 exons
[Tue Apr 28 11:10:43 2015] Caculating GC content in 13: 35 exons
[Tue Apr 28 11:10:43 2015] Finish fasta file
[Tue Apr 28 11:10:43 2015] Loading genesPassQCwithGC.bed
[Tue Apr 28 11:10:43 2015] Processing bam files
[Tue Apr 28 11:10:43 2015] Thread 1 stared
[Tue Apr 28 11:10:43 2015] Thread 1 processing
/home/koen/cnv_tool_comparison/ExonDel_example/example1.bam example1
[Tue Apr 28 11:10:43 2015] Thread 1 processing
/home/koen/cnv_tool_comparison/ExonDel_example/example2.bam example2
[Tue Apr 28 11:10:43 2015] Thread 1 processing
/home/koen/cnv_tool_comparison/ExonDel_example/example3.bam example3
[Tue Apr 28 11:10:43 2015] Thread 2 stared
[Tue Apr 28 11:10:43 2015] Thread 2 processing
/home/koen/cnv_tool_comparison/ExonDel_example/example4.bam example4
[Tue Apr 28 11:10:44 2015] Thread 3 stared
[Tue Apr 28 11:10:44 2015] Thread 4 stared
[Tue Apr 28 11:10:44 2015] Thread 1 finished
[Tue Apr 28 11:10:44 2015] Thread 2 finished
[Tue Apr 28 11:10:44 2015] Thread 3 finished
[Tue Apr 28 11:10:44 2015] Thread 4 finished
[Tue Apr 28 11:10:44 2015] Finish bam file
[Tue Apr 28 11:10:44 2015] Analyzing Exon Deletion
can't open ./report_tmpl.tmpl! at /net/
clusterhn.cluster.com/home/koen/cnv_tool_comparison/ExonDel/Report/Generate.pm
line 30.

(I ran test.modules and it reports that all modules are installed
correctly).

Please let me know if you need more information and/or log files.

Bests,

Koen

—
Reply to this email directly or view it on GitHub
#4 (comment).

pineapple216 · 2015-04-30T08:23:12Z

Hi Shilin,

I've tried running ExonDel again, but now it outputs the following:

[Wed Apr 29 09:55:54 2015] Thread 1 finished
[Wed Apr 29 09:55:56 2015] Thread 2 finished
[Wed Apr 29 09:55:56 2015] Thread 3 finished
[Wed Apr 29 09:55:56 2015] Thread 4 finished
[Wed Apr 29 09:55:56 2015] Thread 5 finished
[Wed Apr 29 09:55:56 2015] Thread 6 finished
[Wed Apr 29 09:55:57 2015] Thread 7 finished
[Wed Apr 29 09:55:57 2015] Finish bam file
[Wed Apr 29 09:55:57 2015] Analyzing Exon Deletion
[Wed Apr 29 09:55:57 2015] Something wrong in running R. Please check the ExonDel.rLog file!
can't find /home/koen/cnv_tool_comparison/ExonDel_results_run1/exonDelsCutoffs.csv

ExonDel.log is empty in the output folder and ExonDel.rLog contains:

Error in read.table(file = file, header = header, sep = sep, quote = quote, :
no lines available in input
Calls: read.bigFile -> read.delim -> read.table
Execution halted

You mentioned before that this can happen because ExonDel can't find any deletions. In my samples however I have 9 positive control samples of which I'm sure that they have duplications and/or deletions.

Kind regards,

Koen

slzhao · 2015-05-01T17:10:07Z

Hello Koen,

If you bam files are not too large, would you please upload them to
internet so that I can download and test them?
If they are too large to upload to internet, would you please use samtools
view and send me part of the content? So that I can see if there are some
format issues.
Thank you!

Best,
Shilin

2015-04-30 3:23 GMT-05:00 Koen Hendriks notifications@github.com:

Hi Shilin,

I've tried running ExonDel again, but now it outputs the following:

[Wed Apr 29 09:55:54 2015] Thread 1 finished
[Wed Apr 29 09:55:56 2015] Thread 2 finished
[Wed Apr 29 09:55:56 2015] Thread 3 finished
[Wed Apr 29 09:55:56 2015] Thread 4 finished
[Wed Apr 29 09:55:56 2015] Thread 5 finished
[Wed Apr 29 09:55:56 2015] Thread 6 finished
[Wed Apr 29 09:55:57 2015] Thread 7 finished
[Wed Apr 29 09:55:57 2015] Finish bam file
[Wed Apr 29 09:55:57 2015] Analyzing Exon Deletion
[Wed Apr 29 09:55:57 2015] Something wrong in running R. Please check the
ExonDel.rLog file!
can't find
/home/koen/cnv_tool_comparison/ExonDel_results_run1/exonDelsCutoffs.csv

ExonDel.log is empty in the output folder and ExonDel.rLog contains:

Error in read.table(file = file, header = header, sep = sep, quote =
quote, :
no lines available in input
Calls: read.bigFile -> read.delim -> read.table
Execution halted

You mentioned before that this can happen because ExonDel can't find any
deletions. In my samples however I have 9 positive control samples of which
I'm sure that they have duplications and/or deletions.

Kind regards,

Koen

—
Reply to this email directly or view it on GitHub
#4 (comment).

pineapple216 · 2015-05-07T08:30:33Z

Hi Shilin,

I can't upload the bam files themselves to the internet.

I however can show you part of the content, below:

NS500285:52:H03THAFXX:4:11601:10221:1845 161 chr1 730853 7 151M = 224208214 223477484 GCAGTGAAGTGCTCCAGAGGCCCCAGCATGCTACATTACAGAAGACTGAACTCAGGAGAGATGAGGAATAATCCCCTCCATCACACCAGACACCAGGAGGGTGTGCCAAGGTGTGAGACATACAGTCCTTACTCTGTTTTTGTTTTGTTTT AAAAAFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFA)F.FFFFFFFFFAAFFFFAFF)FF7FFFFFFFF.FFFF<F.FFFFFFAFAFFFFFFFF<AFF<AFFFF<FFFFFAFFFF<7.F7F<).F)F<<FF7FFAF77 NM:i:1 MD:Z:135T15 AS:i:146 XS:i:141
NS500285:52:H03THAFXX:3:21411:25464:2917 81 chr1 730956 0 151M = 730853 -254 TGCCATGGTGGGAGACATACTGTCCTTACTCTTTTTTTGTTTTGTTTTGCTTTGTGAGACGGAGTTTCACTTTTGTCCCCCAGGCTGGAGTGCAATGGCCCGATCTCGGCTCACTGCAACCTCTGCTTCCTGGGTTCAAGCGATTCTCCAG .FAAF.AF7<).7FF)FFFF)F)A<)7<..FA<FF.AFF)<.FF...7F.FF<F)<<F7AFF<F).F7<F.7FFF.FFFFFAAFA<FFFF.FF7)AF7F7F7FFFFFFFF.FFFFFFFFFF.FFFAFFFFFFFA7.AF<FFFFFFFAAAAA NM:i:4 MD:Z:5A4T9A28T101 AS:i:131 XS:i:131
NS500285:52:H03THAFXX:2:11112:22848:16649 81 chr1 730976 0 20S131M = 730853 -254 GGCCTTGGTGGGTGACTTATAGTCCTTACTCTTTTTTTGTTTTGTTTTGTTTTGTGAGTCGGTGCTTCACTTTTGTCCCCCAGGCTGGAGTGCATTGGCCCGATCTCGGCTCACTGCAACCTCTGCTTCCTGGGTTCAAGCGATTCTCCAG .F7...FA.F.FA<F...)..F.F.F.F.A.F<F<.FFF..F.F)..FF..A7F.FFF.FFFFF.A<AFF).F<FAFFFAF.FFF<FFFF.FFF<<FFF<FFF.FFFF7F.F.FAFFFFFF.FFFFF.FF.FFFA.FFAFFFFFFF7AAA) NM:i:4 MD:Z:38A3A1T29A56 AS:i:111 XS:i:111
NS500285:52:H03THAFXX:4:11508:23866:5603 81 chr1 730984 0 28S123M = 730853 -254 TGCTTTGGTGGGAGTCTTTCAGTCGTTTCTCTTTTTTTGGTTTGTGTTGTTTTGGGTGACGGAGTTTCACTTTTGTCCCCCAGGCTGGTGTGCTATGGCCCGATCTCGGCTCACTGCAACCTCTGCTTCCTGGGTTCAAGCGATTCTCCAG .F))..<F7F.A)A))..)).F.....A.F..A..FAFFA.7)<...FF....F.F7FFFFAAF....A..7F7FFAF<A).FFF.F)<FFF<.A7AFFF<FF<FF<FFFFFFF.7)AFFF<FFAAAAF<<F.F.AA)FFFFF7FF.AAAA NM:i:6 MD:Z:11T5T8T1A31A4A57 AS:i:93 XS:i:93
NS500285:52:H03THAFXX:1:11101:22695:9252 161 chr1 921941 60 151M = 922190 332 GGTTGAACAATTATTTATTCCCACTAGAGGTTCCAGTCACCGTGTCCACGTCCTCACCCTCACTCAGCGCGGCACAGCTTTGTAATTCAGTCCTCCCAGTAGGCGCTCATTCTGGTTTAAATTTGCAATTCCTTAATGATGTCCAACACAG AAAAAAAF<..FA)AFFA)FF7FF<AA.F7FFFFA.)F)FF7F)<.F)7FFAFF<FFFF.A.F.F.FA7FF.)FFF.AA<F.F<FF<.7.FF..F<<AF7FFFA.A7F)F7FF)<F77)FF7.AFF.)..A.A..AF7FFA))A.7A.F). NM:i:12 MD:Z:5T30G1T8T11A12G19A25T8T13A0A6T1 AS:i:96 XS:i:25
NS500285:52:H03THAFXX:1:11203:21316:12602 161 chr1 921941 60 151M = 922122 332 GGTTGTACAATTATTTATTCCCACTAGAGGTTCCAGGCTCCGTGTCCTCGTCCTCACCCCCACTCAGCGCGGGACAGCTTTGTAATTCAGTCATCCCAGTAGGCGCTCATTCTGGTTTTAATTTGCATTTCCTTAATGATGACCAACACTG AAAAAFFFAFFF.FFFAFFFFFFFF.F7FF<FFF<FFFFFFAFFFFFFFFFFFAFFFAF.FFFAF.FFAFFF<.FFFAF<<7<77FFAFFAF.FFFF.AF<<FAFFFA.FFFAFAAF7F7.AF7FAF<FA<F.F.7<A.<<..AF.FA<<< NM:i:2 MD:Z:59A82A8 AS:i:141 XS:i:0

Hopefully this can help you in solving the problem(s).

Bests,

Koen

fvnieuwe · 2015-05-07T14:10:50Z

Dear,

I want to mention that I have the same problem as Koen.

Kind regards,
Filip

slzhao · 2015-05-21T04:09:21Z

Hello Koen and Filip,

I think the bam file format in Koen's email is fine for ExonDel.
For the error messages, in Koen's first email, "Can't find any exon deletions
with 1 windows length" means ExonDel can't find any deletions. But in
Koen's latest email, "Error in read.table ~~", it means the file containing
read counts from bam was not generated correctly.

I think we can fix the "Error in read.table ~~" problem with the following
steps:

Would you please check the content in genesPassQCwithGC.bed.depth and
genesPassWCwithGC.bed. Is it empty or has some content? Would you please
send the content to me?
If the .depth file is empty, then there are some issues in counting
reads from bam file. It may related to format in bed/gtf/fa file. We can
discuss it later;
If the .depth file is not empty, then it should be some bugs in R code.
Would you please download the latest version (1.04) and run it again? I've
added more information in log file and hopefully we can find the bugs by
the log.

Thank you!

Best,
Shilin

2015-05-07 9:10 GMT-05:00 fvnieuwe notifications@github.com:

Dear,

I want to mention that I have the same problem as Koen.

Kind regards,
Filip

—
Reply to this email directly or view it on GitHub
#4 (comment).

VivekTodur · 2015-06-25T02:11:33Z

Dear Shilin,

Can you please provide instructions to download the GTF in the format which is required. When I am downloading GTF it is standard GTF as below

chr1 hg19_refGene start_codon 67000042 67000044 0.000000 + . gene_id "NM_032291"; transcript_id "NM_032291";

Look forward to hear from you,

Thanks
Vivek

slzhao · 2015-06-25T02:18:47Z

Hi Vivek,

It is in the README file:
The .gtf and .bed files could be downloaded at UCSC table browser
http://genome.ucsc.edu/cgi-bin/hgTables?command=start. To download a gtf
file with correct format, please select track as RefSeq Genes in UCSC table
browser. The format of these files were:

#bed file:
#Column1 Column2 Column3
Chromosome StartPosition EndPosition

#bed file and if you want select some genes:
#Column1 Column2 Column3 Column4
Chromosome StartPosition EndPosition Gene

#gtf file (with header):
#bin name chrom strand txStart txEnd cdsStart cdsEnd exonCount
exonStarts exonEnds score name2 cdsStartStat cdsEndStat exonFrames
23 NM_005509 chr5 + 118407083 118584822
118407264 118582914 3
118407083,118433673,1184376292, 118407351,118433799,118437701, 0
DMXL1 cmpl cmpl 0,0,0,

Please let me know if you have any other questions.

Best,
Shilin

2015-06-24 21:11 GMT-05:00 Vivek Todur notifications@github.com:

Dear Shilin,

Can you please provide instructions to download the GTF in the format
which is required. When I am downloading GTF it is standard GTF as below

chr1 hg19_refGene start_codon 67000042 67000044 0.000000 + . gene_id
"NM_032291"; transcript_id "NM_032291";

Look forward to hear from you,

Thanks
Vivek

—
Reply to this email directly or view it on GitHub
#4 (comment).

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Can't find exonDelsCutoffs.csv #4

Can't find exonDelsCutoffs.csv #4

pineapple216 commented Apr 16, 2015

slzhao commented Apr 16, 2015

pineapple216 commented Apr 22, 2015

slzhao commented Apr 24, 2015

pineapple216 commented Apr 28, 2015

slzhao commented Apr 29, 2015

pineapple216 commented Apr 30, 2015

slzhao commented May 1, 2015

pineapple216 commented May 7, 2015

fvnieuwe commented May 7, 2015

slzhao commented May 21, 2015

VivekTodur commented Jun 25, 2015

slzhao commented Jun 25, 2015

Can't find exonDelsCutoffs.csv #4

Can't find exonDelsCutoffs.csv #4

Comments

pineapple216 commented Apr 16, 2015

slzhao commented Apr 16, 2015

pineapple216 commented Apr 22, 2015

slzhao commented Apr 24, 2015

pineapple216 commented Apr 28, 2015

slzhao commented Apr 29, 2015

pineapple216 commented Apr 30, 2015

slzhao commented May 1, 2015

pineapple216 commented May 7, 2015

fvnieuwe commented May 7, 2015

slzhao commented May 21, 2015

VivekTodur commented Jun 25, 2015

slzhao commented Jun 25, 2015