Dheilly_etal-Copy0.ipynb

{
 "metadata": {
  "name": "",
  "signature": "sha256:9718c252c1767fd29c6d0a36a54d98c7403d830869635f62c5fd4ea313c2c245"
 },
 "nbformat": 3,
 "nbformat_minor": 0,
 "worksheets": [
  {
   "cells": [
    {
     "cell_type": "heading",
     "level": 1,
     "metadata": {},
     "source": [
      "Dheilly et al : Resources associated with Gametogenesis in the Pacific Oyster Crassostrea gigas: A Microarrays-Based Analysis Identifies Sex and Stage Specific Genes"
     ]
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "quick links   \n",
      "- [RNAseq join array](#BiGo-Sperm-RNAseq-v-GPL11353-array)   \n",
      "- [Supp data from Dheilly et al](#Supplementary-tables-from-Dheilly-et-al)"
     ]
    },
    {
     "cell_type": "heading",
     "level": 1,
     "metadata": {},
     "source": [
      "Array Design"
     ]
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "<img src=\"http://eagle.fish.washington.edu/cnidarian/skitch/SQLShare_-_View_Query_18EEEE73.png\" alt=\"SQLShare_-_View_Query_18EEEE73.png\"/>"
     ]
    },
    {
     "cell_type": "heading",
     "level": 3,
     "metadata": {},
     "source": [
      "Sigenae Version 6"
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!wget http://dl.dropboxusercontent.com/u/115356/docs/annotable/Roberts_Sigenae6_transcriptome.fa"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "--2014-04-04 12:05:10--  http://dl.dropboxusercontent.com/u/115356/docs/annotable/Roberts_Sigenae6_transcriptome.fa\r\n",
        "Resolving dl.dropboxusercontent.com... 54.225.207.37, 54.243.164.243, 54.225.246.188, ...\r\n",
        "Connecting to dl.dropboxusercontent.com|54.225.207.37|:80... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "connected.\r\n",
        "HTTP request sent, awaiting response... "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "200 OK\r\n",
        "Length: 25210642 (24M) [text/plain]\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Saving to: `Roberts_Sigenae6_transcriptome.fa'\r\n",
        "\r\n",
        "\r",
        " 0% [                                       ] 0           --.-K/s              "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 0% [                                       ] 167,558      806K/s              "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 1% [                                       ] 365,934      876K/s              "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 2% [                                       ] 545,486      872K/s              "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 2% [>                                      ] 730,830      876K/s              "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 3% [>                                      ] 933,054      895K/s              "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 4% [>                                      ] 1,127,582    902K/s              "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 5% [=>                                     ] 1,327,406    910K/s              "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 6% [=>                                     ] 1,520,942    912K/s              "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 6% [=>                                     ] 1,719,814    917K/s              "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 7% [=>                                     ] 1,910,950    917K/s              "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 8% [==>                                    ] 2,108,830    920K/s              "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 9% [==>                                    ] 2,307,702    923K/s              "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        " 9% [==>                                    ] 2,503,182    924K/s              "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "10% [===>                                   ] 2,701,558    922K/s              "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "11% [===>                                   ] 2,902,830    925K/s  eta 24s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "12% [===>                                   ] 3,099,758    926K/s  eta 24s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "13% [====>                                  ] 3,299,582    928K/s  eta 24s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "13% [====>                                  ] 3,497,958    934K/s  eta 24s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "14% [====>                                  ] 3,697,782    937K/s  eta 24s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "15% [=====>                                 ] 3,901,454    941K/s  eta 22s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "16% [=====>                                 ] 4,099,830    945K/s  eta 22s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "17% [=====>                                 ] 4,292,910    938K/s  eta 22s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "17% [=====>                                 ] 4,488,390    944K/s  eta 22s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "18% [======>                                ] 4,692,062    943K/s  eta 22s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "19% [======>                                ] 4,885,142    945K/s  eta 21s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "20% [======>                                ] 5,087,862    943K/s  eta 21s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "20% [=======>                               ] 5,287,686    948K/s  eta 21s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "21% [=======>                               ] 5,484,118    948K/s  eta 21s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "22% [=======>                               ] 5,674,302    947K/s  eta 21s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "23% [========>                              ] 5,875,078    946K/s  eta 20s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "24% [========>                              ] 6,068,158    946K/s  eta 20s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "24% [========>                              ] 6,266,534    946K/s  eta 20s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "25% [=========>                             ] 6,467,806    947K/s  eta 20s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "26% [=========>                             ] 6,669,078    947K/s  eta 20s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "27% [=========>                             ] 6,869,854    951K/s  eta 19s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "28% [=========>                             ] 7,062,934    950K/s  eta 19s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "28% [==========>                            ] 7,262,758    950K/s  eta 19s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "29% [==========>                            ] 7,462,582    950K/s  eta 19s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "30% [==========>                            ] 7,656,118    949K/s  eta 19s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "31% [===========>                           ] 7,853,542    948K/s  eta 18s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "31% [===========>                           ] 8,051,422    948K/s  eta 18s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "32% [===========>                           ] 8,237,262    946K/s  eta 18s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "33% [============>                          ] 8,426,950    945K/s  eta 18s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "34% [============>                          ] 8,602,158    938K/s  eta 18s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "34% [============>                          ] 8,800,534    940K/s  eta 17s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "35% [============>                          ] 8,996,014    938K/s  eta 17s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "36% [=============>                         ] 9,195,838    937K/s  eta 17s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "37% [=============>                         ] 9,386,974    937K/s  eta 17s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "38% [=============>                         ] 9,583,902    937K/s  eta 17s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "38% [==============>                        ] 9,776,486    937K/s  eta 16s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "39% [==============>                        ] 9,963,278    932K/s  eta 16s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "40% [==============>                        ] 10,161,654   931K/s  eta 16s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "41% [===============>                       ] 10,365,326   932K/s  eta 16s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "41% [===============>                       ] 10,494,198   752K/s  eta 16s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "42% [===============>                       ] 10,594,606   729K/s  eta 16s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "42% [===============>                       ] 10,704,158   709K/s  eta 16s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "43% [===============>                       ] 10,889,502   707K/s  eta 16s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "43% [================>                      ] 11,076,790   704K/s  eta 16s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "44% [================>                      ] 11,267,926   705K/s  eta 16s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "45% [================>                      ] 11,456,166   705K/s  eta 16s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "46% [=================>                     ] 11,647,302   712K/s  eta 16s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "46% [=================>                     ] 11,835,542   707K/s  eta 16s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "47% [=================>                     ] 12,022,334   711K/s  eta 16s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "48% [=================>                     ] 12,210,574   709K/s  eta 15s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "49% [==================>                    ] 12,400,262   700K/s  eta 15s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "49% [==================>                    ] 12,594,294   703K/s  eta 15s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "50% [==================>                    ] 12,789,774   709K/s  eta 15s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "51% [===================>                   ] 12,985,254   705K/s  eta 15s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "52% [===================>                   ] 13,179,286   714K/s  eta 14s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "53% [===================>                   ] 13,382,958   708K/s  eta 14s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "53% [====================>                  ] 13,577,486   702K/s  eta 14s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "54% [====================>                  ] 13,781,158   876K/s  eta 14s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "55% [====================>                  ] 13,975,686   901K/s  eta 14s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "56% [====================>                  ] 14,174,062   925K/s  eta 12s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "57% [=====================>                 ] 14,373,390   931K/s  eta 12s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "57% [=====================>                 ] 14,569,366   932K/s  eta 12s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "58% [=====================>                 ] 14,756,158   919K/s  eta 12s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "59% [======================>                ] 14,951,638   925K/s  eta 12s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "60% [======================>                ] 15,139,878   919K/s  eta 11s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "60% [======================>                ] 15,338,254   923K/s  eta 11s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "61% [=======================>               ] 15,541,926   927K/s  eta 11s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "62% [=======================>               ] 15,736,454   930K/s  eta 11s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "63% [=======================>               ] 15,939,174   927K/s  eta 11s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "63% [=======================>               ] 16,131,758   932K/s  eta 10s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "64% [========================>              ] 16,331,582   933K/s  eta 10s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "65% [========================>              ] 16,529,958   932K/s  eta 10s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "66% [========================>              ] 16,712,406   929K/s  eta 10s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "67% [=========================>             ] 16,900,646   925K/s  eta 10s     "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "67% [=========================>             ] 17,090,334   924K/s  eta 9s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "68% [=========================>             ] 17,280,022   921K/s  eta 9s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "69% [==========================>            ] 17,479,350   922K/s  eta 9s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "70% [==========================>            ] 17,670,982   923K/s  eta 9s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "70% [==========================>            ] 17,870,806   922K/s  eta 9s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "71% [==========================>            ] 18,035,878   928K/s  eta 8s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "72% [===========================>           ] 18,230,862   921K/s  eta 8s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "73% [===========================>           ] 18,423,942   928K/s  eta 8s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "73% [===========================>           ] 18,626,662   922K/s  eta 8s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "74% [============================>          ] 18,826,486   929K/s  eta 8s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "75% [============================>          ] 19,015,678   918K/s  eta 7s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "76% [============================>          ] 19,201,518   918K/s  eta 7s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "76% [=============================>         ] 19,394,102   913K/s  eta 7s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "77% [=============================>         ] 19,585,238   917K/s  eta 7s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "78% [=============================>         ] 19,783,614   912K/s  eta 7s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "79% [=============================>         ] 19,981,990   917K/s  eta 6s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "80% [==============================>        ] 20,186,158   924K/s  eta 6s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "80% [==============================>        ] 20,381,638   927K/s  eta 6s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "81% [==============================>        ] 20,578,070   929K/s  eta 6s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "82% [===============================>       ] 20,762,462   922K/s  eta 6s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "83% [===============================>       ] 20,959,390   925K/s  eta 5s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "83% [===============================>       ] 21,150,526   925K/s  eta 5s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "84% [===============================>       ] 21,318,494   913K/s  eta 5s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "85% [================================>      ] 21,519,766   920K/s  eta 5s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "86% [================================>      ] 21,716,694   916K/s  eta 5s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "86% [================================>      ] 21,908,782   913K/s  eta 4s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "87% [=================================>     ] 22,097,518   920K/s  eta 4s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "88% [=================================>     ] 22,279,966   915K/s  eta 4s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "89% [=================================>     ] 22,479,790   920K/s  eta 4s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "89% [==================================>    ] 22,679,614   921K/s  eta 4s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "90% [==================================>    ] 22,880,886   918K/s  eta 3s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "91% [==================================>    ] 23,058,990   918K/s  eta 3s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "92% [==================================>    ] 23,251,078   919K/s  eta 3s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "92% [===================================>   ] 23,438,366   913K/s  eta 3s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "93% [===================================>   ] 23,643,486   918K/s  eta 3s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "94% [===================================>   ] 23,743,398   861K/s  eta 2s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "94% [====================================>  ] 23,921,998   856K/s  eta 2s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "95% [====================================>  ] 24,115,534   858K/s  eta 2s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "96% [====================================>  ] 24,295,582   858K/s  eta 2s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "97% [====================================>  ] 24,500,702   868K/s  eta 2s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "97% [=====================================> ] 24,693,782   861K/s  eta 1s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "98% [=====================================> ] 24,889,262   868K/s  eta 1s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "99% [=====================================> ] 25,089,086   872K/s  eta 1s      "
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r",
        "100%[======================================>] 25,210,642   887K/s   in 28s     \r\n",
        "\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "2014-04-04 12:05:38 (890 KB/s) - `Roberts_Sigenae6_transcriptome.fa' saved [25210642/25210642]\r\n",
        "\r\n"
       ]
      }
     ],
     "prompt_number": 3
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "#tab delimited version\n",
      "!perl -e '$count=0; $len=0; while(<>) {s/\\r?\\n//; s/\\t/ /g; if (s/^>//) { if ($. != 1) {print \"\\n\"} s/ |$/\\t/; $count++; $_ .= \"\\t\";} else {s/ //g; $len += length($_)} print $_;} print \"\\n\"; warn \"\\nConverted $count FASTA records in $. lines to tabular format\\nTotal sequence length: $len\\n\\n\";' Roberts_Sigenae6_transcriptome.fa > Roberts_Sigenae6_transcriptome.tab"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\r\n",
        "Converted 31952 FASTA records in 451733 lines to tabular format\r\n",
        "Total sequence length: 24247683\r\n",
        "\r\n"
       ]
      }
     ],
     "prompt_number": 4
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!awk -F \",\" '{print \">\"$1\"\\n\"$2}' /Volumes/web/cnidarian/GPL11353_v6fasta.csv > /Volumes/web/cnidarian/GPL11353_v6fasta.fa"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [],
     "prompt_number": 1
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!tail /Volumes/web/cnidarian/GPL11353_v6fasta.fa"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        ">AM860865.p.cg.6\r\n",
        "CACAGTGTGAAGCTGTTACATGGTTGCAGCTCAGGTGATGGGAAACCATGTTGCAGTGACGGTAGGTGGAAGTGACGGCCATTTTCAGTTGAATGTATTCAAACCAGTGATCGTCACAAATGTACTACAGTCTGTTAGACTGATCGGAGACTCTTGTGTGTCATTCTCCAAAAACTGTGTGGATGGAATAATACCGAATACAGAGAAGATTAATCGTTTTGTAAATGAATCTCTGATGCTGGTCACAGCACTGAATCCACACATAGGGTACGACCGCGCGGCAAAGATAGCTAAGCATGCTCATACAGGGTCCGCGTTAAAAATGGCCGCCGTGTCACTGCAGATGCTGACTGAGGAGGAGTTTGACATCAAAGTTCAACCAAAAGACATGTTAGGACCAAAGTAATGCCACTGCAGCAGAACAAATTCCTAGACCCAATGAGAGTCATTCGAACATGTATTGGTGGTACACATGTAATAAAATTCAAATCTTGCAAAGAACATACATTAATGTTTTATTTCATCTGTTGGTCTGTGACAATATTTGTCATTCCCAATATTGTCCCCATAATTTTTTCTGTCTTC\r",
        "\r\n",
        ">AM869341.p.cg.6\r\n",
        "ATTTTGCAAGATTTTTGTTGGCTTATAAAGTCAAATTTTGTCGGCTAGATGGCTACCCCAGTATCCAGGAGCGCCAGGAGCAGATGGCTGATTTTAACAGGAATCCATAGGTATTCATTTTCCTGTGAAGCACTACAGCTGGAGGGTTGGGGATCAATCTGGTTGGGGCAGACACTGTGATCATATACGACAGTGACTGGAATCCCCAGTGTGATCTCCAGGCCCAAGACAGGTGTCACAGAATAGGACAGAGTATGCCTGTGGTCATCTACCGCTTAGTGACCACCAACACCATTGACCAGCGCATTGT\r",
        "\r\n",
        ">EE677551.p.cg.6\r\n",
        "ACCTTTGAACATTAACACTCTTTCACATTACAAAATGCTCATATTACAACACCTAGTATTGACACAATTGCTCTCATGATTACAACTCTGTATCAAACTAAAAATGCCAAGTACCAATTATTAATAAGTTTATATGGATTAGTCCTTTGGTCAGTATTTACATGTCCTCTTCCTCGGCTCTGGTCGGCGCCACGAAGGACAATCTGCCCTCGGGGTCACGACTCACCTTGACCTGCCTGCACTCCATGCCCTCGGGT\r",
        "\r\n",
        ">AM860135.p.cg.6\r\n",
        "CGGCAGAACCAGTGGCTGGCCAAAAGGAACAAATCCAGTGTCTTATGCAGCTAAATATGGCATAACGAACCCTTCACCTACGTTAGATCGCCCGATCAATCTGTACCCATTAACAAATTACACATTTGGAACCAAAGAGCCATTGTATGAGAAGGATAGCTCAGTCCCAGCACGGTTTCAGCGTATGCGAGATGAGTTTGAGAAGATTGGAATGAGGCGATCTGTTGAGGGAGTGTTAATTGTACACGAGCACGGACTTCCCCACGTTCTCCTTCTACAACTAGGGACCACATTTTTCAAATTACCTGGGGGAGAGTTGAATTCAGGCGAGGATCAAGTAGAAGGCTTGAAAAGATTATTAACAGAGACCCTGGGAAGACAAGATGGTGGGACTATGGAGTGGGTAGTGGAGGATACTATAGGGAACTGGTGGAGACCAAACTTTGAACCCCCACAGTACCCTTACATCCCAGCACACATCACAAAACCCAAGGAACACAAAAGACTTTTCCTTGTACAGCTACCAGAAAAGGCATTGTTTGCTGTTCCTAGAAATTATAAACTTGTGGCCGCCCCCTTGTTTGAACTATATGACAACAGTGCAGGATATGGGCCAATCATCTCAAGTTTACCTCAAGCTCTAAGTCGGTTCAACTTCATATACAATTGAGTGGGAAGATGCGAAGAACTGTACAACAATATTATTGTGACTTTTTTTATTACTCTGTCTGTAATACTGTCAGCTGTGGCTTGTCAACTTTGTATCACGATCATATCATCATATAATTATATGATTCATCATGGTCGAAAATGTCATTGAGGAATAAAAAAAAATTCAAACAG\r",
        "\r\n",
        ">BQ426856.p.cg.6\r\n",
        "CCTGAAACAACCAAGCAATTTTAGAGATCTGTCAAAACATATAGGTGCTCTGAACCCCACAAGAAGAGAATTTTTTCAGGAGCGTTATAACTCATGGGAGCATGATCAAATCCCACCATTCCATTATGGCACTCATTATTCAACGGCAGCTTTTACTCTGAACTGGCTCATAAGAGTGGAGCCATTTTCTACAATGTTTTTGAACCTTCAAGGTGGCAAATTTGACCACGCCAACAGAACCTTCAGCTCTATAGCTCAGTCTTGGAAGAATTGTCAGAGAGACACTTCTGATGTGAAGGAGTTGATCCCTGAGTTCTACTTTCTCCCAGAAATGTTCATCAATCAAAATAGGTACAAGTTTGGAAAGCAAGAAGATGGCGGAGAAGTTGCTGATGTGGAGATGCCACCATGGGCCAAGAACCCTGATGATTTTGTCCGAATAAACAGAATGGCCTTAGAATCTGAATTTGTGTCTTGTCAACTTCATCATTGGATTGATCTGATATTTGGCTACAAACAAAGAGGTCCAGAAGCAGTGAGGTCCACCAATGTCTTCTATTACCTGACCTACGAAGGCAGTGTGAACCTGGAGAGTATGACTGACCTAGTCATGAAGGAGGCCATAGAGAACCAGATTAAGAGTTTTGGACAGACCCCCACCCAGCTCCTGGCTGAGCCCCACCCTCCCCGCAGTTCTCTGATGCACTTGACTCCGATGATGTTTTCGACAGTCCAGGATGATGTGTGTATGATCATGAAGTTCCTGTCCAACTCCCCGGTCATTCACATCGCCGCCAACACCCACCCTGCCGTTCCCAACCCCGCGGTCACAACCATCACATGTAACCACAACTTTGCTGTCAACAAATGGAACACCACATACCAACTAACCAACACTGGCCTTCAGAGACGATCCCTAGGGGACAACTTTGACGAGAGAATAAAACCTACCCACCAGAGCTTTGTCACTTCAGCAGACAACCGCTTCATCTTTGCCTGTGGATTCTGGGACAAGAGCTTCAGAATATTCAGTTCCGAGTCTGGGAAGATCCTTCAGGTGGTGAATGGCCACTTTGATGTGGTGACCTGTATCACGCGCTCTGAGTGTAACCTGAATCAGGACTGTTACATTGTGACCGGGTCCAAGGACTGTACCGCCATGGTCTGGATGTTCACCTCAAGGAACCAGGCCATCATAGGCGACAATGGAAGTC\r",
        "\r\n"
       ]
      }
     ],
     "prompt_number": 3
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!head /Volumes/web/cnidarian/BiGoRNA_array_v6_tab"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\"Name\"\t\"Chromosome\"\t\"Region\"\t\"Expression value\"\t\"Gene length\"\t\"RPKM\"\t\"Unique gene reads\"\t\"Total gene reads\"\r\n",
        "CU995582.p.cg.6\tCU995582.p.cg.6\t1..1092\t4\t1092\t0.236\t4\t4\r\n",
        "AM862909.p.cg.6\tAM862909.p.cg.6\t1..595\t0\t595\t0\t0\t0\r\n",
        "CU991229.p.cg.6\tCU991229.p.cg.6\t1..1230\t148\t1230\t7.767\t146\t148\r\n",
        "AM863560.p.cg.6\tAM863560.p.cg.6\t1..562\t101\t562\t11.601\t101\t101\r\n",
        "AM868645.p.cg.6\tAM868645.p.cg.6\t1..462\t2\t462\t0.279\t2\t2\r\n",
        "AM856822.p.cg.6\tAM856822.p.cg.6\t1..846\t0\t846\t0\t0\t0\r\n",
        "FP006184.p.cg.6\tFP006184.p.cg.6\t1..287\t16\t287\t3.599\t16\t16\r\n",
        "AM862004.p.cg.6\tAM862004.p.cg.6\t1..808\t132\t808\t10.545\t132\t132\r\n",
        "CU998134.p.cg.6\tCU998134.p.cg.6\t1..1001\t772\t1001\t49.783\t772\t772\r\n"
       ]
      }
     ],
     "prompt_number": 4
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!head /Volumes/web/cnidarian/BiGoRNA_array_v6_tab.txt"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ID\tSig_No\tGene length\tRPKM\tUnique gene reads\tTotal gene reads\r\n",
        "CU995582\tCU995582.p.cg.6\t1092\t0.236\t4\t4\r\n",
        "AM862909\tAM862909.p.cg.6\t595\t0\t0\t0\r\n",
        "CU991229\tCU991229.p.cg.6\t1230\t7.767\t146\t148\r\n",
        "AM863560\tAM863560.p.cg.6\t562\t11.601\t101\t101\r\n",
        "AM868645\tAM868645.p.cg.6\t462\t0.279\t2\t2\r\n",
        "AM856822\tAM856822.p.cg.6\t846\t0\t0\t0\r\n",
        "FP006184\tFP006184.p.cg.6\t287\t3.599\t16\t16\r\n",
        "AM862004\tAM862004.p.cg.6\t808\t10.545\t132\t132\r\n",
        "CU998134\tCU998134.p.cg.6\t1001\t49.783\t772\t772\r\n"
       ]
      }
     ],
     "prompt_number": 6
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "spd=\"/Users/sr320/sqlshare-pythonclient/tools/\"\n"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [],
     "prompt_number": 8
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "#uploading to SQLSHARE\n",
      "!python {spd}singleupload.py -d BiGoRNA_array_v6 /Volumes/web/cnidarian/BiGoRNA_array_v6_tab.txt"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "processing chunk line 0 to 31918 (1.10805797577 s elapsed)\r\n",
        "pushing /Volumes/web/cnidarian/BiGoRNA_array_v6_tab.txt...\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "parsing F8132D65...\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "finished BiGoRNA_array_v6\r\n"
       ]
      }
     ],
     "prompt_number": 9
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!python {spd}fetchdata.py -s \"SELECT * FROM [sr320@washington.edu].[BiGoRNA_array_v6]rna left join [sr320@washington.edu].[GPL11353_array]arr on rna.Sig_No=arr.ContigName\" -f tsv -o /Volumes/web/cnidarian/BiRNAseq_GPL11353_v6ref.txt"
     ],
     "language": "python",
     "metadata": {},
     "outputs": []
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!head /Volumes/web/cnidarian/BiRNAseq_GPL11353_v6ref.txt"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ID\tSig_No\tGene length\tRPKM\tUnique gene reads\tTotal gene reads\tID\tRow\tCol\tProbeName\tContigName\tGB_ACC\tDescription\tSEQUENCE\r",
        "\r\n",
        "CU995582\tCU995582.p.cg.6\t1092\t0.236\t4\t4\t13\t1\t13\tCUST_15609_PI419289827\tCU995582.p.cg.6\tCU995582\t\tCCTGGAATTTAACAATCCACTCCCCCGGGTTTTTCCCTTTTTAAAAATATAAAAAACAAG\r",
        "\r\n",
        "AM862909\tAM862909.p.cg.6\t595\t0\t0\t0\t14\t1\t14\tCUST_4684_PI419289827\tAM862909.p.cg.6\tAM862909\t\tCTACGCTCTACTAATGTCATTTTCAGACATTATCATGACATGTACCAGATGAAATACTAC\r",
        "\r\n",
        "CU991229\tCU991229.p.cg.6\t1230\t7.767\t146\t148\t15\t1\t15\tCUST_13060_PI419289827\tCU991229.p.cg.6\tCU991229\tpredicted protein [Trichoplax adhaerens]\tTAGGCATACCCATCTGTATCATGTCTAGTAGCTATTGCCCTTGAATTATTAGGAATTAAA\r",
        "\r\n",
        "AM863560\tAM863560.p.cg.6\t562\t11.601\t101\t101\t17\t1\t17\tCUST_4942_PI419289827\tAM863560.p.cg.6\tAM863560\t(sp:Q7ZVC2) Clusterin-associated protein 1 homolog OS=Danio rerio GN=cluap1 PE=2 SV=2\tTAAAAGAAGCAAGAAGACTGGCATCAGAAATAACCACCAAAGGAGCAACTTTATATGATC\r",
        "\r\n",
        "AM868645\tAM868645.p.cg.6\t462\t0.279\t2\t2\t18\t1\t18\tCUST_25910_PI419289827\tAM868645.p.cg.6\tAM868645\t\tTGAATACCAAATTGTTGCAATAAAAAATCTGCTACAGAAGAACAACAAGGGTTCTTGTGG\r",
        "\r\n",
        "AM856822\tAM856822.p.cg.6\t846\t0\t0\t0\t19\t1\t19\tCUST_2145_PI419289827\tAM856822.p.cg.6\tAM856822\t\tCCTCGTCAAGACCACAGTGATAAACACAACCACAAATAATGTAGGTTATTAAGATTAGAA\r",
        "\r\n",
        "FP006184\tFP006184.p.cg.6\t287\t3.599\t16\t16\t20\t1\t20\tCUST_22004_PI419289827\tFP006184.p.cg.6\tFP006184\tHomo sapiens 5.8S ribosomal RNA (LOC100008587), non-coding RNA\tGCTCACTAGTTGACCTAACGGACCATTCTGAATAAAAGATTATCATTTATATTGGACTTC\r",
        "\r\n",
        "AM862004\tAM862004.p.cg.6\t808\t10.545\t132\t132\t21\t1\t21\tCUST_28017_PI419289827\tAM862004.p.cg.6\tAM862004\t\tAGCTACGAGTGCTGAATGATGCGAGATTACACAATACATGTGTGTGTCATGGCCGAGTTT\r",
        "\r\n",
        "CU998134\tCU998134.p.cg.6\t1001\t49.783\t772\t772\t22\t1\t22\tCUST_17107_PI419289827\tCU998134.p.cg.6\tCU998134\t\tACCCGAAGTCACTCATTTCCAAATTCAAGGGTTTGGAAAAGTTTCAAATGGGTTTTAAAA\r",
        "\r\n"
       ]
      }
     ],
     "prompt_number": 11
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!python /Applications/q \"SELECT * FROM /Volumes/web/cnidarian/BiRNAseq_GPL11353_v6ref.txt WHERE c1 like CU995582\""
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "query error: no such column: CU995582\r\n"
       ]
      }
     ],
     "prompt_number": 23
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!grep \"CU995582\" /Volumes/web/cnidarian/BiRNAseq_GPL11353_v6ref.txt"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "CU995582\tCU995582.p.cg.6\t1092\t0.236\t4\t4\t13\t1\t13\tCUST_15609_PI419289827\tCU995582.p.cg.6\tCU995582\t\tCCTGGAATTTAACAATCCACTCCCCCGGGTTTTTCCCTTTTTAAAAATATAAAAAACAAG\r",
        "\r\n"
       ]
      }
     ],
     "prompt_number": 29
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!head -3 /Volumes/web/cnidarian/BiRNAseq_GPL11353_v6ref.txt"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "ID\tSig_No\tGene length\tRPKM\tUnique gene reads\tTotal gene reads\tID\tRow\tCol\tProbeName\tContigName\tGB_ACC\tDescription\tSEQUENCE\r",
        "\r\n",
        "CU995582\tCU995582.p.cg.6\t1092\t0.236\t4\t4\t13\t1\t13\tCUST_15609_PI419289827\tCU995582.p.cg.6\tCU995582\t\tCCTGGAATTTAACAATCCACTCCCCCGGGTTTTTCCCTTTTTAAAAATATAAAAAACAAG\r",
        "\r\n",
        "AM862909\tAM862909.p.cg.6\t595\t0\t0\t0\t14\t1\t14\tCUST_4684_PI419289827\tAM862909.p.cg.6\tAM862909\t\tCTACGCTCTACTAATGTCATTTTCAGACATTATCATGACATGTACCAGATGAAATACTAC\r",
        "\r\n"
       ]
      }
     ],
     "prompt_number": 37
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!egrep -wi --color 'CF369228|EF219426|EF219427|EF219428|EF219429' /Volumes/web/cnidarian/BiRNAseq_GPL11353_v6ref.txt"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\u001b[01;31m\u001b[KEF219429\u001b[m\u001b[K\t\u001b[01;31m\u001b[KEF219429\u001b[m\u001b[K.p.cg.6\t2460\t10.758\t45\t410\t12243\t145\t3\tCUST_24587_PI419289827\t\u001b[01;31m\u001b[KEF219429\u001b[m\u001b[K.p.cg.6\t\u001b[01;31m\u001b[KEF219429\u001b[m\u001b[K\thypothetical protein BRAFLDRAFT_118409 [Branchiostoma floridae]\tCAGTGTTTATGGCAGTTTCAGAGGACACTATTGTGTCAACGGAAATACAAAAGATTTTTT\r",
        "\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\u001b[01;31m\u001b[KEF219426\u001b[m\u001b[K\t\u001b[01;31m\u001b[KEF219426\u001b[m\u001b[K.p.cg.6\t1221\t1.004\t1\t19\t21490\t253\t70\tCUST_24584_PI419289827\t\u001b[01;31m\u001b[KEF219426\u001b[m\u001b[K.p.cg.6\t\u001b[01;31m\u001b[KEF219426\u001b[m\u001b[K\thypothetical protein BRAFLDRAFT_118409 [Branchiostoma floridae]\tTTGATCTTGGGGCTGTTAACAACGTTGACAAAGTGGTCATCTATAACCGGAACGTTCAGG\r",
        "\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\u001b[01;31m\u001b[KEF219427\u001b[m\u001b[K\t\u001b[01;31m\u001b[KEF219427\u001b[m\u001b[K.p.cg.6\t1641\t15.656\t52\t398\t32629\t384\t74\tCUST_24585_PI419289827\t\u001b[01;31m\u001b[KEF219427\u001b[m\u001b[K.p.cg.6\t\u001b[01;31m\u001b[KEF219427\u001b[m\u001b[K\thypothetical protein BRAFLDRAFT_118409 [Branchiostoma floridae]\tAGGACGTTTTAGGAATGCATTCATACGTGTTGGAGTATCAATAAATAGACTGAGGAAATG\r",
        "\r\n",
        "\u001b[01;31m\u001b[KCF369228\u001b[m\u001b[K\t\u001b[01;31m\u001b[KCF369228\u001b[m\u001b[K.p.cg.6\t1088\t926.486\t9709\t15616\t33033\t389\t53\tCUST_24740_PI419289827\t\u001b[01;31m\u001b[KCF369228\u001b[m\u001b[K.p.cg.6\t\u001b[01;31m\u001b[KCF369228\u001b[m\u001b[K\thypothetical protein BRAFLDRAFT_125849 [Branchiostoma floridae]\tCCCAAAATAGAGAATTTTCAAGTATGTTGTACCATTGACAGGGGTAAAAGGGAATGTTAA\r",
        "\r\n"
       ]
      },
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\u001b[01;31m\u001b[KEF219428\u001b[m\u001b[K\t\u001b[01;31m\u001b[KEF219428\u001b[m\u001b[K.p.cg.6\t2049\t256.783\t773\t8151\t38965\t459\t35\tCUST_24586_PI419289827\t\u001b[01;31m\u001b[KEF219428\u001b[m\u001b[K.p.cg.6\t\u001b[01;31m\u001b[KEF219428\u001b[m\u001b[K\thypothetical protein BRAFLDRAFT_118409 [Branchiostoma floridae]\tGACGTGCAAGTTTTTGGAGGTTAATTAGACTCTGTTAACCAAGAGCATATACTTTGCTTT\r",
        "\r\n"
       ]
      }
     ],
     "prompt_number": 35
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "!egrep -wi --color 'CU998852' /Volumes/web/cnidarian/BiRNAseq_GPL11353_v6ref.txt"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "\u001b[01;31m\u001b[KCU998852\u001b[m\u001b[K\t\u001b[01;31m\u001b[KCU998852\u001b[m\u001b[K.p.cg.6\t449\t229.304\t1595\t1595\t9555\t113\t35\tCUST_30571_PI419289827\t\u001b[01;31m\u001b[KCU998852\u001b[m\u001b[K.p.cg.6\t\u001b[01;31m\u001b[KCU998852\u001b[m\u001b[K\t(sp:Q9C005) Protein dpy-30 homolog OS=Homo sapiens GN=DPY30 PE=1 SV=1\tCTGTGAACTTGTTACAGTTTTCATGCATTCATCTGTTATTTGTGTCTCGACAGTATCATT\r",
        "\r\n"
       ]
      }
     ],
     "prompt_number": 36
    },
    {
     "cell_type": "heading",
     "level": 3,
     "metadata": {},
     "source": [
      "BiGo Sperm RNAseq v GPL11353 array"
     ]
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "<img src=\"http://eagle.fish.washington.edu/cnidarian/skitch/SQLShare_-_View_Query_18F591B3.png\" alt=\"SQLShare_-_View_Query_18F591B3.png\"/>"
     ]
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "<https://sqlshare.escience.washington.edu/sqlshare/#s=query/sr320%40washington.edu/BiGoRNAseq_GPL11353_v6ref>"
     ]
    },
    {
     "cell_type": "heading",
     "level": 3,
     "metadata": {},
     "source": [
      "Supplementary tables from Dheilly et al "
     ]
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "<img src=\"http://eagle.fish.washington.edu/cnidarian/skitch/SQLShare_-_View_Query_18F5948F.png\" alt=\"SQLShare_-_View_Query_18F5948F.png\"/>"
     ]
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "---    \n",
      "<img src=\"http://eagle.fish.washington.edu/cnidarian/skitch/SQLShare_-_View_Query_18F5959E.png\" alt=\"SQLShare_-_View_Query_18F5959E.png\"/>"
     ]
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "---    \n",
      "<img src=\"http://eagle.fish.washington.edu/cnidarian/skitch/SQLShare_-_View_Query_18F5994E.png\" alt=\"SQLShare_-_View_Query_18F5994E.png\"/>"
     ]
    },
    {
     "cell_type": "markdown",
     "metadata": {},
     "source": [
      "---    \n",
      "<img src=\"http://eagle.fish.washington.edu/cnidarian/skitch/SQLShare_-_View_Query_18F5996D.png\" alt=\"SQLShare_-_View_Query_18F5996D.png\"/>"
     ]
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [],
     "language": "python",
     "metadata": {},
     "outputs": []
    }
   ],
   "metadata": {}
  }
 ]
}