##Using vim with DNA sequences

###Installation Install using Pathogen.

cd ~/.vim/bundle
git clone https://github.com/stveep/biovim.git

Vim needs to be compiled with ruby support. vim --version | grep ruby should show +ruby. Many vim installations have this by default.

###Reverse-complement sequence search Run as follows, e.g. to search for NGG or CCN:

:Biorc NGG

Or in a vimscript, :call Rcsearch("NGG"); or from ruby BioVim.rcsearch("NGG").

This works by converting the search string to a case-insensitive regexp containing the supplied and reverse-complemented string. Results will highlight if hlsearch is set (:set hlsearch).

###In-place reverse complementation

To activate this functionality, add the following lines to your ~/.vimrc file. If you don't have a similar line setting up a 'leader' character, add this:

let mapleader = ","

This sets the 'leader' character to the comma (,). Add the following lines to map the reverse complement operator command to R.

nnoremap <leader>R :set operatorfunc=RcOperator<cr>g@
vnoremap <leader>R :<c-u>call RcOperator(visualmode())<cr>

Restart vim. Now you can reverse complement sequences either using conventional movement operations in vim (hjkl, w, b etc.):

,R<movement>

If your leader character is different, replace the comma with your custom leader. e.g. ,Rw will reverse-complement up until the start of the next "word". ,R2l will reverse-complement the following two bases.

Alternatively, select sequence using visual line (shift-v) or character (v) modes and type the ,R command.

###Lucky BLAT searching

Basic BLAT searching of visual (character or line) highlighted sequence is supported via UCSC's "I'm feeling Lucky" BLAT search. Currently only human hg38 without hacking.

Add to ~/.vimrc:

nnoremap <leader>L :set operatorfunc=LuckyBlat<cr>g@
vnoremap <leader>L :<c-u>call LuckyBlat(visualmode())<cr>
nnoremap <leader>B :set operatorfunc=LuckyBlatURL<cr>g@
vnoremap <leader>B :<c-u>call LuckyBlatURL(visualmode())<cr>

Select sequence as for in-place reverse complement above. ,L prints the location of the top BLAT hit as a message (use :messages to view history). ,B opens default browser with the genomic location of the top BLAT hit.

AGAGCGGGCGCGCCTCTTGCAAGAAATGCAGCGA

shift-V,L 
# =>BLAT: AGAGCGGGCGCGCCTCTTGCAAGAAATGCAGCGA^@
#Position: chr1:226407853-226407886
shift-V,B
# => opens browser with UCSC location above

This is a quick and dirty search that ignores other equally good or near matches - use at own risk!

For more details see plugin/test directory.