Skip to content

Latest commit

 

History

History
189 lines (151 loc) · 7.97 KB

files.rst

File metadata and controls

189 lines (151 loc) · 7.97 KB

Input files

This section describes the input file types accepted by MrBait.

Assembled genomes

mrbait_ only accepts genome assemblies formatted as FASTA. These can represent contigs, scaffolds, or entire chromosomes. According to the FASTA specifications, a sequence should begin with a header line, or short description (indicated by the “>” symbol), followed by a second line containing sequence data. It does not matter if the following lines are interleaved or on a single line, and any blank lines in the file will be ignored, as will any leading or trailing whitespace.

An example FASTA-formatted sequence is given below.

>chr1.scaffold1
ATAGCTCGGCTACGTGATCGCGTGCTC-ATGCTAGCGCTNNNNNNNNATGATTGCTTTT
TGTGTGTGCAAGCACTGCCGRGCTACGCGCTACTGCCRCCTAGTATGTGTGGCCGCTAC
TAGTCCGCGCTAGCTtTtagatctcgtggcgccgcgcgcgtcgcacgatcgtacgcgcc
>chr1.scaffold2
ATCGTGCTGCGGCGCTGCCTCAGC…
…
…
…

Annotating genomes with VCF

mrbait_ also supports supplementing genomic sequences with coordinate-reference SNP data (e.g. obtained from population-level sequencing) using the Variant Call Format:

##fileformat=VCFv4.2
##FORMAT=<ID=GT,Number=1,Type=Integer,Description="Genotype">
##FORMAT=<ID=GP,Number=G,Type=Float,Description="Genotype Probabilities">
##FORMAT=<ID=PL,Number=G,Type=Float,Description="Phred-scaled Genotype Likelihoods">
#CHROM       POS     ID      REF     ALT     QUAL    FILTER  INFO    FORMAT  SAMP001 SAMP002
chr1.scaffold1       48      rs11449 G       A       .       PASS    .       GT      0/0     0/1
chr1.scaffold1       47      rs11449 T       A       .       PASS    .       GT      0/0     0/1
chr1.scaffold2       1 rs84825 A     T       .       PASS    .       GT:GP   0/1:.   0/1:0.03,0.97,0
…
…

It is important to note that the VCF format can communicate much more information than mrbait_ will utilize. The CHROM and POS columns will be parsed to locate the reference position for each SNP, and the REF and ALT columns to write a new consensus base at that position using IUPAC ambiguity codes (e.g. C/T = Y). More functionality will be added in future versions of mrbait_.

It is highly recommended you add variant data if it is available, as it will be used both for finding adequately conserved regions for bait design, as well as for filtering target regions for those which capture flanking SNPs.

Annotating genomes with GFF

mrbait_ can also make use of genomic features provided using the Generic Feature Format (GFF), independently or in addition to any variant data provided via VCF. mrbait assumes that input GFF files follow the version 3 GFF specification <https://github.com/The-Sequence-Ontology/Specifications/blob/master/gff3.md>_:

##gff-version 3
chr1.scaffold1       .       gene    10      180     .       +       .       ID=gene0001;Alias=targets
chr1.scaffold1       .       mRNA    20      180     .       +       .       ID=mrna0001;Parent=gene0001
chr1.scaffold1       .       exon    10      128     .       +       .       ID=tfbs00001;Parent=gene0001
…
…

Columns should be separated by tabs and defined according to the GFF3 standard (e.g. column 1 contains the sequence ID). mrbait will use the sequence ID (column 1) to map coordinates in GFF columns 4 and 5 to the reference provided in your FASTA file, thus these identifiers must be identical. mrbait will also categorize features internally by the type (e.g. “exon”) given in column 3, and by any alias assigned in the attributes column (column 9). All other columns are ignored. You can use either type or alias to tell mrbait_ to target those features for bait design.

If you are not targeting all of a single type (e.g. CDS, or exon), you can either pre-filter your GFF file prior to loading, or you can annotate features of interest using the Alias attribute.

Multiple genome alignments

mrbait_ reads two different input file types for multiple genome alignments. These can be provided using the Multiple Alignment Format (MAF), or the eXtended Multi-FastA (XMFA) formats.

The MAF format is output by several multiple alignment programs, including MAFFT and Mugsy, and take the following general form:

##maf version=1 scoring=tba.v8
# tba.v8 (((human chimp) baboon) (mouse rat))
# multiz.v7
# maf_project.v5 _tba_right.maf3 mouse _tba_C
# single_cov2.v4 single_cov2 /dev/stdin

a score=5062.0
s hg16.chr7    27699739 6 + 158545518 RAAAGAGATGCTAAGCCAATGAGTTGATGTCTCTCAATGTGTG
s panTro1.chr6 28862317 6 + 161576975 RAAAGAGATGCTAAGCCAATGAGTTGTTGTCTCTCAATGTGTG
s baboon         241163 6 +   4622798 TAAAGAGATGCTAAGCCAATGAGTTGTTGTCTCTRAATGTGTG
s mm4.chr6     53303881 6 + 151104725 TAAAGAGATGCTAAGCCAATGAGTTGTTGTCGCTCAATGTGTG
s rn3.chr4     81444246 6 + 187371129 taaggaGATGCTAAGCCAATGAGTTGTTGTCGCTCAATGTGTG

…
…
…

Comment lines (starting with “#”) are ignored by mrbait_. Alignment blocks (considered by mrbait_ to each represent different loci) are started with “a”, followed by sequence lines starting with “s”. Source, strand, and coordinate positions are not informative for mrbait_, nor are lines starting with other letters (which can be used in the MAF format to communicate additional information about the preceding sequence, such as quality scores).

The eXtended Multi-FastA (XMFA) format output by the multiple-genome aligner MAUVE (which outputs it as “.alignment”) is an extension of the standard FASTA format to allow alignment blocks from many different loci, with header lines representing identifiers for the aligned sequence, and start-end coordinates representing the alignment block location within the genome, followed by the sequence:

>1:1-230 +
ATAGC-NAATC--GC…
>2:210-440 -
ATTGGCCAATCCCC…
>3:3-230 +
TTA-CCAAGC--GC…
=
…
…

Alignment blocks are delimited by the “=” symbol. All alignment blocks are assumed by mrbait_ to represent separate, discontinuous loci. Note that because no individual 'alignment block' in the .xmfa file is guaranteed to contain the same genome representatives, no reference coordinates are saved by mrbait. This means that additional annotation via GFF or VCF cannot be added to whole-genome alignments provided in .xmfa format.

Reduced representation data

Alignments from reduced-representation methods such as restriction-site associate DNA sequencing methods (RADseq) can be input using the MAF or XMFA formats, or using the “.loci” format output by the RADseq assembly pipeline pyrad or its successor ipyrad. This format shows individual loci delimited by a line starting with “//” which features additional annotation of variants and parsimony-informative sites:

>PopA001     GTGTGATAGTAGTGATGTATTTTATAATATATATTATCGGATAT……
>PopA002     GTGTGARAGTAGTGATGTATTTTATAATATATATTATCGGATAT……
>PopB001     GTGTGACAGTAGTGATGTATTTTATAATATATATTATCGGATAT……
>PopB002     GAGTGATAGTAGTGATGTATTTTATAATATATATTATCGGATAT……
//            *      *                                        |1
…
…
…

mrbait ignores annotation information (since it parses variants anyways to generate a consensus sequence), and only uses the “//” delimiter to distinguish between alignment blocks. Creating a .loci file from other formats can be accomplished relatively easily. For example, a series of separate alignments (each as .fasta), could be converted to the .loci format using the following bash command:

for file in `ls example*.fasta`; do
  awk 'BEGIN{ORS=""}$1~/^\>/{print $01"\t";next}{print $0"\n"}' $file
  >> example.loci;
  echo "//" >> example.loci;
done