This script searches a fasta genome for instances of a consensus sequence while also requiring a particular 3' sequence.
Under the hood, we use pygr (for loading the genome) and motility (for performing the search).
If you're on our github page, you can click on the "Download Zip" button. Otherwise, try this link:
https://github.com/uci-cbcl/consensus_search/archive/master.zip
To perform the search used in the genesis paper, first download the xenopus genome:
wget ftp://ftp.xenbase.org/pub/Genomics/JGI/Xentr7.1/xenopus_tropicalis_v7.1.tar.gz tar xfz xenopus_tropicalis_v7.1.tar.gz mv 20100930/sequences/Xenopus_tropicalis.main_genome.scaffolds.fasta . rm -r xenopus_tropicalis_v7.1.tar.gz 20100930
Then install motility and pygr (easy_install pygr).
Finally, you can reproduce the results from the paper by running:
python consensus_search.py --genome Xenopus_tropicalis.main_genome.scaffolds.fasta \ --consensus GGAACTGGCCCCTGCAAACA --required_3p_seq NGG --mismatches 5 \ --outfile results.bed
This search will allow up to 5 mismatches to the tyrosinase site above enforcing a degenerate NGG PAM sequence at the 3' end. To search for mismatch sites to your own target site of interest, substitute your sequence in place of the above consensus after --consensus.
Note that any of the IUPAC letters can be used in the consensus and required sequences. Specifically,
IUPAC code | Allowed letter |
---|---|
A | Adenine |
C | Cytosine |
G | Guanine |
T | Thymine |
U | Uracil (converted to T for DNA search) |
R | Purine (A or G) |
Y | Pyrimidine (C or T) |
M | C or A |
K | T, or G |
W | T, or A |
S | C or G |
B | C, T, or G (not A) |
D | A, T, or G (not C) |
H | A, T, or C (not G) |
V | A, C, or G (not T) |
N | Any base (A, C, G, or T) |
For additional usage instructions, run:
python consensus_search.py --help
Or shoot me an email at jake.biesinger@gmail.com