-
Notifications
You must be signed in to change notification settings - Fork 15
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
fix: add flag for stating that candidate variants are atomic (in such…
… cases, no realignment against SNVs and MNVs should happen because nearby indels can induce false positives if they are not considered in the realignment) (#400)
- Loading branch information
Showing
11 changed files
with
301 additions
and
4 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
228 changes: 228 additions & 0 deletions
228
tests/resources/testcases/test_uzuner_fp_snv_on_ins/candidates.vcf
Large diffs are not rendered by default.
Oops, something went wrong.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,2 @@ | ||
>6 | ||
AAATGAAACCGGGTAAACGCGCCTGGGGCTCTCGCCGGTCGAGGGTCTGGGCGGGTCCCGCGGCCTCAGGGAGGCGGATCTCGGACCCGGAGACTCGGGGCGACCCGGGCCGTACGTGGGGGATGGGGAGTCGTGACCTGCGCCCCGGGCCGGGGTCACTCACCGGCCTCGCTCTGGTTGTAGTAGCCGCGCAGGTTCCGCAGGCTCTCTCGGTCAGTCTGTGCCTGGGCCTTGTAGATCTGTGTGTTCCGGTCCCAATACTCCGGCCCCTCCTGCTCTATCCACGGCGCCCGCGGCTCCTCTCTCGGACTCGCGGCGTCGCTGTCGAACCTCACGAACTGGGTGTCGTCCACGTAGCCCACTGAGATGAAGCGGGGCTCCCCGCGGCCGGGCCGGGACACGGAGGTGTAGAAATACCTCATGGAGTGGGAGCCTGGGGGTGAGGAGGGGCTGAGACCCGCCCGACCCTCCTCCCGGCGCGGCTCCTCAGGTCCTGCGCCCCCGCCTGCGGTCCCCTCGCTCCTCCCGGCAGAGGCCATTTCCCTCCCGACCCGCACTCACCGGCCCAGGTCTCGGT |
Binary file not shown.
6 changes: 6 additions & 0 deletions
6
tests/resources/testcases/test_uzuner_fp_snv_on_ins/scenario.yaml
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,6 @@ | ||
samples: | ||
sample: | ||
universe: "[0.0,1.0]" | ||
|
||
events: | ||
present: "sample:]0.0,1.0]" |
28 changes: 28 additions & 0 deletions
28
tests/resources/testcases/test_uzuner_fp_snv_on_ins/testcase.yaml
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,28 @@ | ||
expected: | ||
allelefreqs: | ||
# write down a list of expressions of the form | ||
- sample == 0.0 | ||
|
||
# necessary bam files | ||
samples: | ||
sample: | ||
path: 'sample.bam' | ||
properties: '{"insert_size":{"mean":150.73021840315073,"sd":76.48661586376208},"max_del_cigar_len":14,"max_ins_cigar_len":18,"frac_max_softclip":0.9900990099009901,"max_read_len":101,"max_mapq":60,"gap_params":{"prob_insertion_artifact":-7.469450748118796,"prob_deletion_artifact":-8.191662061622653,"prob_insertion_extend_artifact":-0.9516818568143385,"prob_deletion_extend_artifact":-0.4580555877859265},"hop_params":{"prob_seq_homopolymer":[null,null,null,null],"prob_ref_homopolymer":[null,null,null,null],"prob_seq_extend_homopolymer":[null,null,null,null],"prob_ref_extend_homopolymer":[null,null,null,null]},"wildtype_homopolymer_error_model":{"2":0.0001651729006327695,"1":0.0013056524526209399,"-1":3.9326881103040365e-6,"4":0.000043259569213344394,"22":3.9326881103040365e-6,"3":0.00001966344055152018,"-2":0.000023596128661824215,"0":0.9987690686214749},"initial":false}' | ||
options: '{"Preprocess":{"kind":{"Variants":{"reference":"?","candidates":"?","bam":"?","report_fragment_ids":true,"omit_mapq_adjustment":true,"atomic_candidate_variants":true,"reference_buffer_size":10,"min_bam_refetch_distance":1,"alignment_properties":null,"output":"?","propagate_info_fields":[],"protocol_strandedness":"Opposite","realignment_window":64,"max_depth":200,"omit_insert_size":false,"pairhmm_mode":"exact","log_mode":"default","output_raw_observations":null}}}}' | ||
|
||
|
||
# candidate variant | ||
candidate: 'candidates.vcf' | ||
|
||
scenario: 'scenario.yaml' | ||
|
||
|
||
|
||
|
||
# reference sequence | ||
reference: | ||
path: 'ref.fa' | ||
|
||
mode: Generic | ||
|
||
version: '4' |