scaff_reads: Segmentation fault

[zj-wien]

Hi there,

scaff_reads can only produce genome-BC_1.fastq.gz, but not genome-BC_2.fastq.gz. Here I list information as follows. Please help to fix it.

Thanks a lot

command line:

Scaff10X/src/scaff_reads -nodes 30 input.dat genome-BC_1.fastq.gz genome-BC_2.fastq.gz

# error information
58211 Segmentation fault Scaff10X/src/scaff-bin/scaff_BC-reads-2 MySample_S1_L001_R1_001.fastq.name MySample_S1_L001_R2_001.fastq MySample_S1_L001_R2_001.fastq.RC2 > try.out

cups & mem

#SBATCH --cpus-per-task=30
#SBATCH --mem=500G

input.dat

q1=MySample_S1_L001_R1_001.fastq (base size: 150Gb )
q2=MySample_S1_L001_R2_001.fastq (base size: 150Gb)

fastq

@CL100073098L1C001R001_7
CCCAATGGGACAATGGCAGGGCTGCCTATGGGGGAACCGGCATTGCTGTGAGGGTCGGGGGGACTATTGTATCTGTAAAGGATCAGCCATGGCCAGAAGTAGGTTTCTGAGCTGAGCGGTGACAGACTGTGCCCTTTTCCTGGCAGGAGG
+
@:GFFDFFFFF9FFFCFGFFDFGEFFE@FFFFFDEF@FF:F?DFGFF@FGFFFEDFEFFFGF;=FFFFGFFGGFFEBFCGE5F>BCFFBFFFFFFCF1BFAGFCDEFEF7FEFF,FGFADF3DBD=FFC84FFFGBFF7GF:DFDFF=EF
@CL100073098L1C001R001_9
CTGCGTTTCGCGGCATGCTTTCTAGAAGCTTAAGTTGTCTGTTTTTCCACCCTCCAAATTGTCTGACCACTTGTTGATAGTAGCAATTCCATTTTAATACCTTATGTCATAAGTATTTTAAGCAACCAAAAGATTCCTTTATTTTTTGCA
+
FFFGFFFFFGGB;FFGGFEGEGEEGGCFGEEE=GFFGEGEGFFGGCEGFGDFGBFFBBGFEGDFEFEGBEFBBGGG:GGBDFDFDGGGF?ECF@F@GEAEAEEEEEGF>GDFDEEEECFF,GFFFE1FGGBEGCEG@EAC?DCGEAEB5@

[zning-sanger]

Hi,

Thanks for the email. When you run

/lustre/scratch117/sciops/team117/hpag/zn1/project/bird/hummingbird/QC/10x/bCalAnn1_S1_L001_R1_001.fastq.gz

this will produce a temporary directory which contains all the files. Could you do ls -lrt and send me the file list?

Best regards,

Zemin Ning

[zj-wien]

oops~ I deleted them all. I think scaff_reads can only handle a certain volume of reads. Because scaff_reads works after I split the giant fastq file into ~15 files (6Gb gzipped file).

…

On Mon, May 11, 2020 at 11:30 AM Zemin Ning ***@***.***> wrote: Hi, Thanks for the email. When you run /lustre/scratch117/sciops/team117/hpag/zn1/project/bird/hummingbird/QC/10x/bCalAnn1_S1_L001_R1_001.fastq.gz this will produce a temporary directory which contains all the files. Could you do ls -lrt and send me the file list? Best regards, Zemin Ning — You are receiving this because you authored the thread. Reply to this email directly, view it on GitHub <#17 (comment)>, or unsubscribe <https://github.com/notifications/unsubscribe-auth/ANTNC7VEYEBQXDFKQLTF5LTRQ7AUPANCNFSM4M44ZNAQ> .

-- *Zongji Wang*

[zning-sanger]

You can run scaff10x directly, rather than run staff_reads to get two read files, basically you don't need them. It saves disk space when you use "-data file.dat".