haystack

Primer finding (needle) in contigs (haystack)

Requirements:

Requires Python 3.x, BioPython and Primer3.

All requirements can be installed using the following command (either in virual environment or standard environment):

$ pip install -r requirements.txt

Example usage:

Haystack will discover primers with specific settings in a given fasta file that contains one or more contigs. Example usage is shown below:

# will display result in line
$ python haystack.py file.fasta

# will display in file
$ python haystack.py file.fasta > test.out

# example output
    Analyzing: ./file.fasta
    Contig: contig.f1
    [{'combo': (250, 269, 288),
    'ga_f': 'CCGAAGGTGAGTGAAACCACCGCGAAGAGCTAGAGGATCCCCG',
    'ga_r': 'CCGAATTGCCCCTTGACTACGGCGAAGAGCTTTTGAGTCGACCTG',
    'primer_f': 'CCGTAGTCAAGGGGCAATTCGG',
    'primer_r': 'CGGTGGTTTCACTCACCTTCGG',
    'primers_info': [[57.65, 0.0, -2.3], [57.8, -0.8, -2.77]],
    'virus_hed_dg': -2.16}]

$ [...]

Fasta files can be batch imported into the program with wildcard characters.

# will analyze all fasta files in current folder with surrounding 5 G or C
# nucleotides on either end of primer
$ python haystack.py --gcPad 5 *.fasta

Arguments and Flags

# file

Required - Must be a fasta file or a collection of fasta files (by wildcard specification)

Contig area to look

# --contigBoundary

Optional (int) - Contig boundary for haystack to start searching in bp. Default is 50bp.

# --maxContigs

Optional (int) - Maximum number of contigs to analyze per fasta file. Default is 3.

Primer general settings

# --minLen

Optional (int) - Minimum primer length in bp. Default is 20bp.

# --maxLen

Optional (int) - Maximum primer length in bp. Default is 27bp.

# --gcPad

Optional (int) - Number of G or C nucleotides to have for beginning and end of. Default is 3.

# --minTm

Optional (float) - Minimum melting temperature in deg C. Default is 56 deg C.

# --maxTm

Optional (float) - Maximum melting temperature in deg C. Default is 58 deg C.

Primer interaction settings

# --hp

Optional (float) - Minimum hairpin delta G in kcal/mol. Default is -9 kcal/mol.

# --hoD

Optional (float) - Minimum homodimer delta G in kcal/mol. Default is -9 kcal/mol.

# --heD

Optional (float) - Minimum heterodimer delta G in kcal/mol with forward and reverse primer. Default is -9 kcal/mol.