Skip to content

xwBio/RRBSsim

Repository files navigation

RRBSsim

RRBSsim: reduced representation bisulfite sequencing simulator for next-generation sequencing

1.Introduction

RRBSsim can produce paired-end RRBS reads, with significant attributes of real data, such as
RRBS library construction, distribution of CpGs methylation level, sequencing error(substitution,
insertion, deletion), quality score. Including four steps below:
(i) Simulation of reference genome with sequencing variation: it can be achived by software,
pIRS(ftp://ftp.genomics.org.cn/pub/pIRS/.).
(ii) Simulation of reference genome with methylated CpGs:we generate methylation values of CpG
in the genome using a Beta model. Methylation levels of CpGs within a read are generated to account
for the strong dependence of methylation among CpG sites within a genomic region in real data.
(iii) Generate simulated RRBS reads: the above modified reference genome is digested by a restriction
enzyme (e.g., MspI) in silico and the position of generated fragments is marked.
(iiii) Sequencing error profile: we produce an empirical error profile from enough large training datasets
that it can be used to generate simulated Illumina reads.

2.System requirements

  To test pyfasta, type below commond in the console :

 	$python
      	>>>import pyfasta
    	>>>quit()

3.Usage :

	$python RRBSsim.py -h
	Usage: RRBSsim.py [options]

	General:			
	-h/--help		Output help information.
	-v/--version		Output version information.
	--seed <int>        	Simulated seed. Default is function of system time and varing among different simulations.
	-f/--fasta	        Input single reference sequence in the fasta format(usually having extension .fa).
				Specifying either -f or --genome_folder is mandatory.
	--genome_folder </../../> Input the path to the genome folder including multiple reference sequences
				in the fasta format (usually having extension .fa). It may be an absolute or relative
				path. Specifying either -f or --genome_folder is mandatory.
	-d <int>	        Expectation of sequencing depth (>0),exponential distribution are supposed here. Default: 30.
	-l/--length <int>   	Read length (>0), read1 and read2 are the same length. Default: 100 bp.                         
	-s/--single_end	Simulated single-end read pattern.
	-p/--paired_end	Simulated paired-end read pattern (default).
	--non_directional   	Directional: reads1 is the same direction with reference sequencing (Watson strand) and read
				is from Crick strand.
				Non-directional: reads1 and reads2 can be of all four bisulfite strands.
				Default: directional.
	--adapter1          	The ligated adapter sequence of the  first end of RRBS fragments. Default: Illumina universal
                    		adapter 'ACACTCTTTCCCTACACGACGCTCTTCCGATCT'.
	--adapter2          	The ligated adapter sequence of the  second end of RRBS fragments. Default: Illumina universal
                    	a	dapter 'GATCGGAAGAGCACACGTCTGAACTCCAGTCAC'.
	--non_meth_adapter  	The cytosines of adapters is unmethylated. Default is methylated.
	--non_meth_end_repair_bases The cytosines of end-repair bases is unmethylated. Default is methylated.
	--min <int>	        The minimum size-selected fragment length of RRBS library (library size) (>0). Default: 40 bp.
	--max <int>         	The maximum size-selected fragment length of RRBS library (library size) (>0). Default: 220 bp.
	--cut_site          	The cutting site of restricted enzyme is separated by '-'. For example, cutting site of MspI
				'C-CGG';here,at most two cutting sites are supported and they must separated by comma (,);
				Default is 'C-CGG'.
	-o/--output	        Prefix of output file. Default is set by name of input file.
	--nPosInfo	    	Output position information into the output file. Default is True.
	--SAM	            	Output alignment results in SAM format. Default is not.
	-R/--ref_methInfo	Output the reference methylation information. Default is not.
	
	
	DNA methylation:
	note: All the default values below are estimated from real RRBS data of lung cancer.
	--CG_level  <float>	CG methylation level (0~1). Default: 0.44.
	--CHG_level <float>	CHG methylation level (0~1). Default: 0.03.
	--CHH_level <float>	CHH methylation level (0~1). Default: 0.03.
	
	--CG_rate  <float>	mCG/CG rate (0~1). Default: 0.67.
	--CHG_rate <float>	mCHG/CHG rate (0~1). Default: 0.375.
	--CHH_rate <float>	mCHH/CHH rate (0~1). Default: 0.375.
	
	--mCG_level <float>	mCG methylation level (0~1). Default: 0.65.
	--mCHG_level <float>	mCHG methylation level (0~1). Default: 0.08.
	--mCHH_level <float>	mCHH methylation level (0~1). Default: 0.08.
	--mCGS  <float>		Standard deviation of mCG_level (0~(1-mCG_level)*mCG_level).
				Default: (1-mCG_level)*mCG_level/2.0.
	--mCHGS <float>		Standard deviation of mCHG_level (0~(1-mCHG_level)*mCHG_level).
				Default: (1-mCHG_level)*mCHG_level/2.0.
	--mCHHS <float>		Standard deviation of mCHH_level(0~(1-mCHH_level)*mCHH_level).
				Default: (1-mCHH_level)*mCHH_level/2.0.
	--cr  <float>	    	Cytosines conversion rate [0~1]. Default: 0.998.
	
	
	SNP:
	-S	                File with SNP information, specifying location and frequency of SNPs.format is:
                    		Chromosome position	strand	frequency_of_A frequency_of_T frequency_of_C frequency_of_G
                    		chr10	1	+	0	0.4	0	0.6
                    		chr10	2	+	0.3	0.2	0.1	0.4
	--non_SNP	        Do not add SNP. Default is add (based on prior probability).
	--homo_freq <float>	The frequency of homozygous SNPs [0~(1-Z)]. Default: 0.0005.
	--heter_freq <float>	The frequency of heterozygous SNPs [0~(1-Y)]. Default: 0.001.
	
	
	Reads quality profiles:
	-q/--quality <float>	Quality score (mean value of quality score). Default: 0.95 (95% of highest score).
	--qs <float>	    	Standard deviation of -q (0~(1-q)*q). Default: (1-q)*q/2.
	--rand_quals	    	Randomly introduce quality value. Default: uniform quality score.
	--rand_error	    	Randomly introduce sequencing errors by sequencing quality value(Q =-10*log10(e), Q is the 
				sequencing quality value (Phred score),e is the error rate ). Default is not.
	
	--input_quals       	Introduce quality value empirically obtained from real data. Default: on.
	--matrix_qual_R1    	Input the file including the probability matrix of  quality value counts at each position for reads1.
	--matrix_qual_R2    	Input the file including the probability matrix of  quality value counts at each position for reads2.
	--phred33_quals     	FastQ qualities are ASCII transformation of that Phred quality plus 33. Default: on.
	--phred64_quals     	FastQ qualities are ASCII transformation of that Phred quality plus 64. Default: off.

4.Example :

(1) Base quality profiles Generator

	python base_quality_profile_R1.py -i rrbs.R1.fastq
	python base_quality_profile_R2.py -i rrbs.R2.fastq

Output file:

	base_quality_profile.R1 , base_quality_profile.R2
file format:

	position        !       "       #       $       %       &       '       (       )
	0       0       0       34344   0       0       0       0       0       0
	1       0       0       819     0       0       0       0       0       0
	2       0       0       1148    0       0       0       4       0       47060
	3       0       0       1407    0       0       416     889     0       29268

Format descriptions:

	(1) position of base
	(2)- number of base related to each ASCII shift of quality value 

(2) Generate the diploid genome sequence with variation

	pirs diploid -i hg19.fa -c 0
Output file:
	
	hg19.snp.indel.invertion.fa

(3) Generate simulated RRBS with reads

	python RRBSsim.py -f hg19.snp.indel.invertion.fa --CG_level 0.6 -R --cut_site C-CGG
	
Output file (1):

	rrbssim.1.fq, rrbssim.2.fq 
file format (1):
	
	@HWUSI-EAS100R:6:73:3307:22982#0/1
	CGGGAGTTCGTAGAGGCGGCGGTTCGGGGAGAAATTTTAGGTACGGTTGAAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCC
	+
	B?@DA8DFHDCGDHGEIIBGDH?HH1FEFIIIB?FDICJJHGI;GJJH@GHFAGIJGFHBD>I>:D>A7ADA#7@EDCBD29D#D=DDDC4C;CC>#A:#
	@HWUSI-EAS100R:6:73:47639:49782#0/1
	CGGGAGTTCGTAGAGGCGGCGGTTCGGGGAGAAATTTTAGGTACGGTTGAAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCC
	+
	@B@FFADFFHFH@HCFH)H)JBGJCDJJJIJIEDBD#HIFHBJFIHIJJHFDH>JBIAIHIDH?##CD3BF=DC#:>?ACD##<>C@D#BD4<C9##?D:


Output file (2):

	rrbssim.Crick.sam, rrbssim.Crick.sam
	
Output file (3):

	rrbssim.ref
	
File format (3):

	chr1      1       G       G               0.002   0
	chr1      2       A       A               1       0
	chr1      3       T       T               1       0
	chr1      4       C       C       CHH     0.002   0
	chr1      5       C       C       CHG     0.002   0
	chr1      6       C       C       CG      0.002   0
	chr1      7       G       G       CG      0.805144911452  0
	chr1      8       C       C       CG      0.953731797262  0
	

Format descriptions(3):

	(1) chromosome 
	(2) position 
	(3) base of origin reference genome
	(4) base of reference genome with variation
	(5) context (CG/CHG/CHH)
	(6) methylation level
	(7) mutation rate

5.update & support

please refer to https://github.com/xwBio/RRBSsim or email to xwsun@zju.edu.cn

About

RRBSsim: reduced representation bisulfite sequencing simulator for next-generation sequencing

Resources

License

Stars

Watchers

Forks

Releases

No releases published

Packages

 
 
 

Contributors