This is an ASCII to "Fake DNA" translator. It's basic text expansion on a specific map. I used perl so as not to depend on too many small unix programs piped together. Also, it's more obvious how to edit the map this way.

The input text should certainly be ASCII, not UTF8. You should down-convert to ASCII before using this app. It does, however, show you text which could not be translated in the output. If "a" is not translated, it will output "__a__". You can search for __ for untranslated characters. My experience so far is that Unicode will pass through this way for you to cut out.

The example text is "Darwin: On the Origin of Species 6th Edition". It was previously translated this way, so it is a good test. I also took some random blog posts from others and tested those successfully (but didn't include them here).

Input is "input.txt" file. It's hard coded inside. Change it if you'd like.
I was using macports-perl, so my shebang is #!/opt/local/bin/perl You probably want to change it to /usr/local/perl, or whatever works.

Example:
$ cat input.txt
I will here give a brief sketch of the progress of opinion on the Origin
of Species. Until recently the great majority of naturalists believed
that species were immutable productions, and had been separately
created. This view has been ably maintained by many authors. Some few
naturalists, on the other hand, have believed that species undergo
modification, and that the existing forms of life are the descendants
by true generation of pre existing forms. Passing over allusions to
the subject in the classical writers (Aristotle, in his "Physicae
Auscultationes" (lib.2, cap.8, s.2), after remarking that rain does no
...
$ ./ascii2gen.pl
TTCTCTTACTTCCCGCCGTCTTTAAAGATTAAGTCTGGGTTCTAGAAGTCTAAATCTAATATTTTCAAGTTGTCTATGCCAAAGTTTCCCTTATCTGGCTTGTCTTTTTTAAAGTCTATAATTGGCGGGATTAAGATGATGTCTGGCTTGTCTGGCATATTCGGATTCGGCGGATCTGGCGGATCTTTTTTAAAGTCTGGCATTTTCGGGTTCGGATCGGGCTTGTCTATGATAAAGCCCTTCAAGATGTCATCTTATGGATTTTTCCCGTCTATTAAGCCCAAGGGATTTCCGCTCTCTTTTTTAAAGTCTGGGATTAAGAAATTTTCTGGTAAACCTGGCATTTTCTTTCTCTCTGGCTTGTCTGGAAAATTTTATATTAAACCGTTCATGTTTATGTCTAATAAGCCGTTCAAGTAGAAGAACTCGTTTTTAAAATTTTCTATGATAAAGCCCTTCAAGATGTCTTACAAGATTAAGTCTTTCGGTGGTTATTTTAAAAATCCGAAGTCTATAATTGGCAACTATCCCTTTTTCGGCG
...