Skip to content
identify pre-miRNAs using CNN models trained on huamn pre-miRNAs dataset
Python
Branch: master
Clone or download
Fetching latest commit…
Cannot retrieve the latest commit at this time.
Permalink
Type Name Latest commit message Commit time
Failed to load latest commit information.
.idea
bin
src
temp
testData revision Dec 8, 2018
.Rhistory
README.md revision Dec 8, 2018
isPreMiR.py revision Dec 8, 2018

README.md

###################################################################################### Using Trained CNN model to predict pre-miRNAs. Data are from the human pre-miRNAs and hairpin structure sequences from human coding regions.

######################################################################################

USAGE: python isPreMiR.py -s RNAsequence for example: python isPreMiR.py -s CUCCGGUGCCUACUGAGCUGAUAUCAGUUCUCAUUUUACACACUGGCUCAGUUCAGCAGGAACAGGA

      python isPreMiR.py -i inputFilePath [-o outputFilePath]

(note:The length of RNA should be not more than 180, all the input RNA sequence will be truncated or padded into 180 length)

Requirements

  • Python 3
  • Tensorflow > 0.12
  • Numpy
  • RNAfold (/bin/RNAfold)

Training

We trained the CNN model,RNN model and the concat model to train the dataset.

Evaluating

Evaluate the trained model on test dataset.

You can’t perform that action at this time.