bio-ipcress
is a programmatic interface to the ipcress
in-silico PCR software, which
is bundled with exonerate.
You can run a PCR:
require 'bio-ipcress'
#hits the first and last bits of the Methanocella_conradii_16s.fa
primer_set = Bio::Ipcress::PrimerSet.new(
'GGTCACTGCTA','GGCTACCTTGTTACGACTTAAC'
)
# Run ipcress on a template sequence, specified in as a FASTA file
results = Bio::Ipcress.run(
primer_set,
'Methanocella_conradii_16s.fa', #this file is in the test/data/Ipcress directory
{:min_distance => 2, :max_distance => 10000})
#=> An array of Bio::Ipcress::Result objects, parsed from
#
#Ipcress result
#--------------
# Experiment: AE12_pmid21856836_16S
# Primers: A B
# Target: gi|335929284|gb|JN048683.1|:filter(unmasked) Methanocella conradii HZ254 16S ribosomal RNA gene, partial sequence
# Matches: 19/20 14/15
# Product: 502 bp (range 2-10000)
#Result type: forward
#
#...AAACTTAAAGGAATTGGCGG......................... # forward
# ||||| ||| |||||| |||-->
#5'-AAACTYAAAKGAATTGRCGG-3' 3'-CRTGTGTGGCGGGCA-5' # primers
# <--| |||||||||||||
#..............................CGTGTGTGGCGGGCA... # revcomp
#--
#ipcress: gi|335929284|gb|JN048683.1|:filter(unmasked) AE12_pmid21856836_16S 502 A 826 1 B 1313 1 forward
#-- completed ipcress analysis"
# This Bio::Ipcress::Result object now holds info about the result:
results.length #=> 1
res = results[0]
res.experiment_name #=> 'AE12_pmid21856836_16S'
res.primers #=> 'A B'
res.target #=> 'gi|335929284|gb|JN048683.1|:filter(unmasked) Methanocella conradii HZ254 16S ribosomal RNA gene, partial sequence'
res.matches #=> '19/20 14/15'
res.product #=> '502 bp (range 2-10000)'
res.result_type #=> 'forward'
res.forward_matching_sequence #=> 'AAACTTAAAGGAATTGGCGG'
res.forward_primer_sequence #=> 'AAACTYAAAKGAATTGRCGG'
res.reverse_primer_sequence #=> 'CRTGTGTGGCGGGCA'
res.reverse_matching_sequence #=> 'CGTGTGTGGCGGGCA'
res.length #=> 502
res.start #=> 826
res.forward_mismatches #=> 1
res.reverse_mismatches #=> 1
There appears to be a slight bug in iPCRess, in the way it handles primers with 'wobble' bases like the
last base of AAACTY,
which indicates that both AAACTC and AAACTT are added as primers.
IPCress always suggests that there is at least a single mismatch,
when this is not always the case. To workaround this, the
Result#recalculate_mismatches_from_alignments
method re-computes the
number of forward and reverse mismatches.
#...AAACTTAAAGGAATTGGCGG......................... # forward
# ||||| ||| |||||| |||-->
#5'-AAACTYAAAKGAATTGRCGG-3' 3'-CRTGTGTGGCGGGCA-5' # primers
# <--| |||||||||||||
#..............................CGTGTGTGGCGGGCA... # revcomp
res = Bio::Ipcress::Result.new
res.forward_matching_sequence = 'AAACTTAAAGGAATTGGCGG'
res.forward_primer_sequence = 'AAACTYAAAKGAATTGRCGG'
res.reverse_matching_sequence = 'CGTGTGTGGCGGGCA'
res.reverse_primer_sequence = 'CRTGTGTGGCGGGCA'
res.recalculate_mismatches_from_alignments #=> [0,0]
gem install bio-ipcress
You'll also need to install exonerate
Information on the source tree, documentation, examples, issues and how to contribute, see
http://github.com/wwood/bioruby-ipcress
The BioRuby community is on IRC server: irc.freenode.org, channel: #bioruby.
If you use this software, please cite exonerate
This Biogem is published at #bio-ipcress
Copyright (c) 2012 Ben J Woodcroft. See LICENSE.txt for further details.