Created new test for charge

KarrLab · Jul 5, 2018 · 13308f5 · 13308f5
1 parent 1701131
commit 13308f5
Showing 1 changed file with 3 additions and 25 deletions.
diff --git a/tests/test_core.py b/tests/test_core.py
@@ -420,35 +420,13 @@ def test_get_mol_wt(self):
 
         # MPN001
         self.assertAlmostEqual(self.prot1.get_mol_wt(), 43856.113, delta=0.3)
-
+        # MNP011
         self.assertAlmostEqual(self.prot2.get_mol_wt(), 26922.957, delta=0.3)
 
     def test_get_charge(self):
-        # Test is based on Collagen Type IV a3 (https://pubchem.ncbi.nlm.nih.gov/compound/44511378)
-        dna1 = core.DnaSpeciesType(seq=Bio.Seq.Seq(
-            'TGTAATTATTATTCTAATTCTTATTCTTTTTGGTTAGCTTCTTTAAATCCTGAACGT', alphabet=Bio.Alphabet.DNAAlphabet()))
-        cell1 = dna1.cell = core.Cell()
-        cell1.knowledge_base = core.KnowledgeBase(translation_table=1)
-
-        gene1 = core.GeneLocus(id='gene1', cell=cell1, polymer=dna1,
-                               start=1, end=dna1.get_len(), strand=core.PolymerStrand.positive)
-        tu1 = core.TranscriptionUnitLocus(
-            id='tu1', genes=[gene1], polymer=dna1)
-        prot1 = core.ProteinSpeciesType(id='prot1', gene=gene1, cell=cell1)
-        self.assertEqual(prot1.get_charge(), 0)
+        self.assertEqual(self.prot1.get_charge(), 1)
 
-        # Test is based on Tuftsin (hhttps://pubchem.ncbi.nlm.nih.gov/compounds/156080)
-        dna1 = core.DnaSpeciesType(seq=Bio.Seq.Seq(
-            'ACTAAACCTCGT', alphabet=Bio.Alphabet.DNAAlphabet()))
-        cell1 = dna1.cell = core.Cell()
-        cell1.knowledge_base = core.KnowledgeBase(translation_table=1)
-
-        gene1 = core.GeneLocus(id='gene1', cell=cell1, polymer=dna1,
-                               start=1, end=dna1.get_len(), strand=core.PolymerStrand.positive)
-        tu1 = core.TranscriptionUnitLocus(
-            id='tu1', genes=[gene1], polymer=dna1)
-        prot1 = core.ProteinSpeciesType(id='prot1', gene=gene1, cell=cell1)
-        self.assertEqual(prot1.get_charge(), 2)
+        self.assertEqual(self.prot2.get_charge(), 12)
 
 
 class PolymerLocusTestCase(unittest.TestCase):