more SNPlocs needs eliminated for non-interactive tests

DESCRIPTION

@@ -1,7 +1,7 @@
 Package: trena
 Type: Package
 Title: Fit transcriptional regulatory networks using gene expression, priors, machine learning
-Version: 1.5.4
+Version: 1.5.5
 Date: 2018-11-26
 Author: Seth Ament <seth.ament@systemsbiology.org>, Paul Shannon <pshannon@systemsbioloyg.org>, Matthew Richards <mrichard@systemsbiology.org>
 Maintainer: Paul Shannon <paul.thurmond.shannon@gmail.com>

inst/unitTests/test_FootprintFinder.R

@@ -295,6 +295,7 @@ test_getFootprintsInRegionWithVariants <- function()
 #----------------------------------------------------------------------------------------------------
 explore_variantsInFootprints <- function()
 {
+   if(!interactive()) return()   # avoid need for huge SNPlocs file
 
    # how does   rs13384219  A->G
    #   gtcagtagtggtggaaccagcatgc[A/G]aattagacaatgtgacttcatagcc, chr2:57907323

inst/unitTests/test_MotifMatcher.R

@@ -175,6 +175,7 @@ test_getSequence <- function(indirect=FALSE)
 #----------------------------------------------------------------------------------------------------
 test_.parseVariantString <- function()
 {
+   if(!interactive()) return () # remove need for huge SNPlocs package
    mm <- MotifMatcher(genomeName="hg38", pfms=list())   # no actual pfms needed here
 
    tbl.variant <- trena:::.parseVariantString(mm, "rs13384219")
@@ -305,6 +306,8 @@ test_.injectSnp <- function()
 #  chr2:57907323:A:G
 test_getSequenceWithVariants <- function()
 {
+   if(!interactive()) return()
+
    printf("--- test_getSequenceWithVariants")
 
    mm <- MotifMatcher(genomeName="hg38", pfms=list())
@@ -406,6 +409,8 @@ test_findMatchesByChromosomalRegion <- function()
 #----------------------------------------------------------------------------------------------------
 test_findMatchesByChromosomalRegion_contrastReferenceWithVariant <- function()
 {
+   if(!interactive()) return()
+
    printf("--- test_findMatchesByChromosomalRegion_contrastReferenceWithVariant")
 
      # the vrk2 promoter snp,  chr2:57907313-57907333

inst/unitTests/test_Trena.R

@@ -305,6 +305,8 @@ test_getProximalPromoterMouse <- function(){
 #----------------------------------------------------------------------------------------------------
 test_assessSnp <- function()
 {
+   if(!interactive()) return()
+
     printf("--- test_assessSnp")
 
     trena <- Trena("hg38")
@@ -375,6 +377,8 @@ test_assessSnp <- function()
 # match level # returns all three kinds of match: in.both. wt.only, mut.only
 test_assessSnp_allTypesWithDeltas <- function()
 {
+    if(!interactive()) return()
+
     printf("--- test_assessSnp_allTypesWithDeltas")
 
     trena <- Trena("hg38")