Skip to content

Web component for visualising RNA secondary structure in standard orientations

License

Notifications You must be signed in to change notification settings

RNAcentral/r2dt-web

Folders and files

NameName
Last commit message
Last commit date

Latest commit

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

R2DT-Web

This is an embeddable component that you can include into your website to visualise RNA secondary structures.

This plugin is written in React/Redux. It is bundled as a Web Component, so it should not clash with your website's javascript or CSS.

How to use

To use the latest stable version without worrying about updates, use the component's javascript package available at Github:

<script type="text/javascript" src="https://rnacentral.github.io/r2dt-web/dist/r2dt-web.js"></script>

If you prefer to install this package and perform the updates manually, see the Installation section.

This tool can be used in two ways:

1- Allow the user to enter a sequence and search for the secondary structure.

For that, you just need to insert this html tag somewhere in your html:

<r2dt-web />

To show some examples, use:

<r2dt-web 
    examples='[
        {"description": "RNA5S1-8", "sequence": "GUCUACGGCCAUACCACCCUGAACGCGCCCGAUCUCGUCUGAUCUCGGAAGCUAAGCAGGGUCGGGCCUGGUUAGUACUUGGAUGGGAGACCGCCUGGGAAUACCGGGUGCUGUAGGCUUU"},
        {"description": "TRT-TGT2-1", "sequence": "GGCTCCATAGCTCAGTGGTTAGAGCACTGGTCTTGTAAACCAGGGGTCGCGAGTTCGATCCTCGCTGGGGCCT"}
    ]'
/>

You can also customise some elements of this embeddable component. See what you can change here. The example below changes the color of the buttons:

<r2dt-web
    customStyle='{
      "searchButtonColor": "#007c82",
      "clearButtonColor": "#6c757d"
    }'
/>

For a minimal example, see index.html.

2- Given a specific URS, show the secondary structure

To show the secondary structure for a specific sequence, you need to pass the Unique RNA Sequence identifier (URS), for example:

<r2dt-web search='{"urs": "URS000044DFF6"}' />

Click here to see how you can find an RNAcentral identifier for an RNA sequence.

Obviously, you can automate this process by passing the URS as a variable, for example:

<r2dt-web search='{"urs": "{{ variable }}"}' />

For a minimal example, see urs-example.html.

Installation

Download this package directly from Github.

git clone https://github.com/RNAcentral/r2dt-web.git

Now you can add the component's javascript bundle (it contains all the styles and fonts) to your web page either directly or through an import with Webpack:

<script type="text/javascript" src="/r2dt-web/dist/r2dt-web.js"></script>

You will need to run the git pull command whenever there are updates.

Attributes/parameters

This component accepts a number of attributes. You pass them as html attributes and their values are strings (this is a requirement of Web Components):

layout

Parameters that you can use to customise some elements of this embeddable component

parameter description
fixCss fix the CSS. Use "fixCss": "true" if the button sizes are different
linkColor change the color of the links
searchButtonColor change the color of the Search button
clearButtonColor change the color of the Clear button
titleColor change the color of the Secondary structure text
titleSize change the size of the Secondary structure text
hideTitle Use "hideTitle": "true" to hide the title
legendLocation Use "legendLocation": "right" to show the legend side by side with secondary structure

Developer details

Local development

  1. npm install

  2. npm run serve to start a server on http://localhost:8080/

  3. npm run clean to clean the dist folder of old assets

  4. npm run build to generate a new distribution.

Notes

This embed is implemented as a Web Component, wrapping a piece of code in React/Redux.

Being a Web Component, it isolates CSS styles from the main page to avoid clash of styles with it. The CSS styles and fonts are bundled into the javascript inline via Webpack 3 build system, see webpack.config.js file. Upon load of r2dt-web.js, the component registers itself in the custom elements registry.

Web Components accept input parameters as strings. That means that we have to parse parameters in Web Component initialization code and pass the resulting objects as props to React. Here are some examples of passing the parameters to the Web Component or from Web Component to React:

About

Web component for visualising RNA secondary structure in standard orientations

Resources

License

Stars

Watchers

Forks

Releases

No releases published

Packages

No packages published