Quality string length is not equal to sequence length, but this is not true

[CarlosMenFer]

I have received this error message when aligning single-end Illumina reads.

EXITING because of FATAL ERROR in reads input: quality string length is not equal to sequence length
@HISEQ:206:HVK53ADXX:1:2109:20411:84904
TGGAAAATGAAACCGATGAGAGAGAACTGGATTTCACCCACGCTGGCAATTGCCACGCCGAAGACGATGAGCAAGA
CCCFFFFFHHHHHJJIIJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJHHHFDDDDDDDDDDDDDDDC
SOLUTION: fix your fastq file

I have checked the FASTQ file and the read which is referred to in the error message is:
@HISEQ:206:HVK53ADXX:1:2109:20411:84904 1:N:0:ATCACG
TGGAAAATGAAACCGATGAGAGAGAACTGGATTTCACCCACGCTGGCAATTGCCACGCCGAAGACGATGAGCAAGA
+
CCCFFFFFHHHHHJJIIJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJHHHFDDDDDDDDDDDDDDDC

Sequence and quality string (2nd and 4th lines) have the same length (77).

I attach the log files. This is from STAR 2.6.1c

sample_Log.txt

But the same occurs when I tried with 2.7.1a and 2.7.2b.

[CarlosMenFer]

When I modified my FASTQ file by removing the description field all ID lines (after space), STAR works. The original read names are:
@HISEQ:206:HVK53ADXX:1:2109:20411:84904 1:N:0:ATCACG

An I convert this to:
@HISEQ:206:HVK53ADXX:1:2109:20411:84904

[alexdobin]

Hi Carlos,

this is likely caused by some formatting problem at the end of the read name file, e.g. an extra space at the end, or some other invisible control character.

Cheers
Alex