Support for Fasta records with multiple marker definitions #124
Conversation
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
standage
commented
May 1, 2023
Comment on lines
+89
to
+93
| loci = defaultdict(Locus) | ||
| for marker in markers: | ||
| print(marker.fasta) | ||
| loci[marker.locus].markers.append(marker) | ||
| for locus in loci.values(): | ||
| print(locus.fasta) |
There was a problem hiding this comment.
CLI update: store requested markers by locus, and then output the relevant locus sequences.
Comment on lines
+435
to
+437
| class Locus: | ||
| def __init__(self, markers=None): | ||
| self.markers = list() if markers is None else markers |
There was a problem hiding this comment.
Most of the code enabling this improved handling is part of this new Locus class. It replicates some of the features originally implemented for the Marker class. I considered removing those configuration features and only allowing configuration of e.g. delta, min length, etc., for Locus objects. But I think we need to maintain these features on a per-marker for other output modes.
Comment on lines
+667
to
+674
| >mh02KK-134 GRCh38:chr2:160222879-160223013 mh02KK-134.v3=20,44,59 mh02KK-134.v1=20,44,59,123 mh02KK-134.v2=20,44,59,65,107,123 mh02KK-134.v4=20,44,59,65,72,87,107,123 | ||
| TACCCTTGGCAGGAACCCTCACTACCTAAGGATGGGCAATGGCTTATGAGTGAGAAACACGGAGCCGTGGGAACTCAGAA | ||
| TGACATGCTACCTGGAGATTGTGGTAACGCCCTGTTTTTTTGTGGGCATATCTA | ||
| >mh14SHY-003 GRCh38:chr14:57983921-57984213 mh14SHY-003.v1=10,14,16,26,102,108,109,161,192,199 mh14SHY-003.v4=10,14,102,108,199,262,281 mh14SHY-003.v3=102,108,199 mh14SHY-003.v2=102,108,199,262,281 | ||
| GTAGGAGTGATGTACGGGGCACCTACTTGGGGTTCACATGCTGGCCCCTTTATTGAGTTCATTCTGAATCCAGAAGCTTG | ||
| GCAGAGTTCAGCCAGATGGCAGGGTGAGCGCCCTGCCTTCCTGGTAGTCTCTTCTTCTGCAAGGGAATAGGAGGCGTTCA | ||
| CCCTCCTTTGTTCAAGAGTCTATTTCTAGGGGCCTATCAGCCCAGGGTCCCTTCTCCAGCTTTCTCAGGAGGCCCCACAT | ||
| CATCAGGCAATTAGCTCTCTAGTGGGTATAACTGCTACTGCCACAACCACTG |
There was a problem hiding this comment.
This new test captures what the new output looks like for loci with multiple marker definitions.
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment
Add this suggestion to a batch that can be applied as a single commit.
This suggestion is invalid because no changes were made to the code.
Suggestions cannot be applied while the pull request is closed.
Suggestions cannot be applied while viewing a subset of changes.
Only one suggestion per line can be applied in a batch.
Add this suggestion to a batch that can be applied as a single commit.
Applying suggestions on deleted lines is not supported.
You must change the existing code in this line in order to create a valid suggestion.
Outdated suggestions cannot be applied.
This suggestion has been applied or marked resolved.
Suggestions cannot be applied from pending reviews.
Suggestions cannot be applied on multi-line comments.
Suggestions cannot be applied while the pull request is queued to merge.
Suggestion cannot be applied right now. Please check back later.
This PR updates the FASTA output mode of the
microhapdb markercommand. MicroHapDB has long been build around a "one locus, one marker" paradigm, and accordinglymicrohapdb marker --format=fastawould generate one FASTA record per marker. As part of MicroHapDB's improved support for alternative marker definitions at a locus, only one sequence is output per locus, with multiple SNP lists included for convenience as requested.Closes #117.