skip tests if the cloning class used happens to be Storable, see bug …

…#3447

t/SeqTools/SeqUtils.t

@@ -584,74 +584,79 @@ my ($fragment_feat_lig) = grep ($_->primary_tag eq 'frag_feat1', $product->get_S
 ok( $fragment_feat_lig, 'the fragment feature1 is now a feature of the product');
 is_deeply( [$fragment_feat_lig->start, $fragment_feat_lig->end], [17,19], 'start and end of a feature on the fragment are correct after insertion with "flip" option');
 
-# test clone_obj option (create new objects via clone not 'new')
-my $foo_seq_obj = Bio::Seq::Foo->new( 
-  -seq =>'aaaaaaaaaaccccccccccggggggggggtttttttttt',
-  -display_id => 'seq1',
-  -desc       => 'some sequence for testing'
-);
-for ($composite_feat1, $feature1, $feature2, $feature3, $feature4, $feature5) {
-    $foo_seq_obj->add_SeqFeature( $_ );
-}
-$foo_seq_obj->annotation($coll);
-
-dies_ok(
-  sub {
-    $product = Bio::SeqUtils->delete( $foo_seq_obj, 11, 20, { clone_obj => 0} );
-  },
-  "Trying to delete from an object of a custom Bio::Seq subclass that doesn't allow calling 'new' throws an error"
-);
-
-lives_ok(
-  sub {
-    $product = Bio::SeqUtils->delete( $foo_seq_obj, 11, 20, { clone_obj => 1} );
-  },
-  "Deleting from Bio::Seq::Foo does not throw an error when using the 'clone_obj' option to clone instead of calling 'new'"
-);
-
-isa_ok( $product, 'Bio::Seq::Foo');
 
-# just repeat some of the tests for the cloned feature
-ok( 
-  grep ($_ eq 'deletion of 10bp', 
-    map ($_->get_tag_values('note'), 
-      grep ($_->primary_tag eq 'misc_feature', $product->get_SeqFeatures)
-    )
-  ),
-  "the product has an additional 'misc_feature' and the note specifies the lengths of the deletion'"
-);
-($composite_feat1_del) = grep ($_->primary_tag eq 'comp_feat1', $product->get_SeqFeatures);
-ok ($composite_feat1_del, "The composite feature is still present");
-isa_ok( $composite_feat1_del, 'Bio::SeqFeature::Generic');
-isa_ok( $composite_feat1_del->location, 'Bio::Location::Split', "a composite feature that spanned the deletion site has been split up, Location");
-
-# ligate with clone_obj
-dies_ok(
-  sub {
-    $product = Bio::SeqUtils->ligate( 
-      -recipient => $foo_seq_obj, 
-      -fragment  => $fragment_obj, 
-      -left      => 10, 
-      -right     => 31,
-      -flip      => 1
-    ); 
-  },
-  "'ligate' without clone_obj option dies with a Bio::Seq::Foo object that can't call new"
-);
-
-lives_ok(
-  sub {
-    $product = Bio::SeqUtils->ligate( 
-      -recipient => $foo_seq_obj, 
-      -fragment  => $fragment_obj, 
-      -left      => 10, 
-      -right     => 31,
-      -flip      => 1,
-      -clone_obj => 1,
-    ); 
-  },
-  "'ligate' with clone_obj option works with a Bio::Seq::Foo object that can't call new"
-);
+SKIP: {
+    skip("Storable::dclone not supported yet for Bio::SeqUtils, see ", 9) if $Bio::Root::Root::CLONE_CLASS eq 'Storable';
+
+    # test clone_obj option (create new objects via clone not 'new')
+    my $foo_seq_obj = Bio::Seq::Foo->new(
+      -seq =>'aaaaaaaaaaccccccccccggggggggggtttttttttt',
+      -display_id => 'seq1',
+      -desc       => 'some sequence for testing'
+    );
+    for ($composite_feat1, $feature1, $feature2, $feature3, $feature4, $feature5) {
+        $foo_seq_obj->add_SeqFeature( $_ );
+    }
+    $foo_seq_obj->annotation($coll);
+
+    dies_ok(
+      sub {
+        $product = Bio::SeqUtils->delete( $foo_seq_obj, 11, 20, { clone_obj => 0} );
+      },
+      "Trying to delete from an object of a custom Bio::Seq subclass that doesn't allow calling 'new' throws an error"
+    );
+
+    lives_ok(
+      sub {
+        $product = Bio::SeqUtils->delete( $foo_seq_obj, 11, 20, { clone_obj => 1} );
+      },
+      "Deleting from Bio::Seq::Foo does not throw an error when using the 'clone_obj' option to clone instead of calling 'new'"
+    );
+
+    isa_ok( $product, 'Bio::Seq::Foo');
+
+    # just repeat some of the tests for the cloned feature
+    ok(
+      grep ($_ eq 'deletion of 10bp',
+        map ($_->get_tag_values('note'),
+          grep ($_->primary_tag eq 'misc_feature', $product->get_SeqFeatures)
+        )
+      ),
+      "the product has an additional 'misc_feature' and the note specifies the lengths of the deletion'"
+    );
+    ($composite_feat1_del) = grep ($_->primary_tag eq 'comp_feat1', $product->get_SeqFeatures);
+    ok ($composite_feat1_del, "The composite feature is still present");
+    isa_ok( $composite_feat1_del, 'Bio::SeqFeature::Generic');
+    isa_ok( $composite_feat1_del->location, 'Bio::Location::Split', "a composite feature that spanned the deletion site has been split up, Location");
+
+    # ligate with clone_obj
+    dies_ok(
+      sub {
+        $product = Bio::SeqUtils->ligate(
+          -recipient => $foo_seq_obj,
+          -fragment  => $fragment_obj,
+          -left      => 10,
+          -right     => 31,
+          -flip      => 1
+        );
+      },
+      "'ligate' without clone_obj option dies with a Bio::Seq::Foo object that can't call new"
+    );
+
+    lives_ok(
+      sub {
+        $product = Bio::SeqUtils->ligate(
+          -recipient => $foo_seq_obj,
+          -fragment  => $fragment_obj,
+          -left      => 10,
+          -right     => 31,
+          -flip      => 1,
+          -clone_obj => 1,
+        );
+      },
+      "'ligate' with clone_obj option works with a Bio::Seq::Foo object that can't call new"
+    );
+}
 
 sub uniq_sort {
     my @args = @_;