Skip to content

HTTPS clone URL

Subversion checkout URL

You can clone with HTTPS or Subversion.

Download ZIP
Fetching contributors…

Cannot retrieve contributors at this time

253 lines (250 sloc) 11.784 kb
;; Modified by adf on Sat Nov 9 17:38:25 1996
;; Modified by adf on Sat Nov 9 16:27:39 1996
;; Modified by kam on Mon Nov 20 12:58:58 1995
;; Modified by kxm on Sat Nov 5 01:21:01 1994
;; Modified by kxm on Sat Nov 5 01:12:11 1994
;; Modified by kxm on Sat Nov 5 00:44:35 1994
;; Modified by kxm on Sat Nov 5 00:03:23 1994
;; Modified by kxm on Fri Nov 4 23:58:34 1994
;; Modified by kxm on Fri Nov 4 23:17:50 1994
;; Modified by kxm on Fri Nov 4 23:12:24 1994
;; Modified by kxm on Fri Nov 4 22:57:56 1994
;; Modified by kxm on Fri Nov 4 12:15:17 1994
;; Modified by kxm on Thu Nov 3 21:30:26 1994
;; Modified by kxm on Thu Nov 3 19:40:25 1994
;; Modified by kam on Thu Mar 18 09:56:44 1993
;; Modified by kam on Fri Mar 12 11:51:25 1993
; LOCUS HIVU455
;
; Modified by kam on Mon Jul 20 12:24:18 1992
; Modified by kxm on Fri Nov 4 12:15:17 1994
; Written from MASE, from file "HIV1TAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
A_U455
ATGGAGCCAGTAGATCCTAACCTAGAGCCCTGGAAACACCCGGGAAGTCAGCCTACAACTGCTTGTAGCA
ACTGTTATTGTAAAGTGTGTTGCTGGCATTGCCAACTTTGCTTTCTGAAAAAAGGCTTAGGCATTTCCTA
TGGCAAGAAGAAGCGGAAACCCCGACGAGGACCTCCTCAAGGCAGTAAGGATCATCAAACTCTTATACCA
AAGCAACCCTTGCCCCAATCCCAGAGGGTCTCGGCAGGCCAGGAAGAATCGAAGAAGAAGGTGGAGAGCA
AGGCAAAGACAGATCGATTCGCT
; LOCUS HIVHXB2R
;
; Modified by kam on Mon Jul 20 12:24:18 1992
; Modified by kxm on Fri Nov 4 12:15:17 1994
; Written from MASE, from file "HIV1TAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
B_HXB2R
ATGGAGCCAGTAGATCCTAGACTAGAGCCCTGGAAGCATCCAGGAAGTCAGCCTAAAACTGCTTGTACCA
ATTGCTATTGTAAAAAGTGTTGCTTTCATTGCCAAGTTTGTTTCATAACAAAAGCCTTAGGCATCTCCTA
TGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACAGTCAGACTCATCAAGCTTCTCTATCA
AAGCAACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAG
AGACAGAGACAGATCCATTCGATTAG
; HUMAN IMMUNODEFICIENCY VIRUS TYPE 1 (UG268) PROVIRAL DNA
; ENCODING ENV, TAT, VPU, REV, AND NEF GENES.
; Modified by kxm on Thu Nov 3 16:33:55 1994
; Modified by kxm on Thu Nov 3 17:45:53 1994
; Modified by kxm on Thu Nov 3 17:56:16 1994
; Modified by kxm on Thu Nov 3 18:05:51 1994
; Modified by kxm on Thu Nov 3 18:56:08 1994
; Modified by kxm on Fri Nov 4 12:15:17 1994
; Modified by cxc on Mon Nov 7 11:17:23 1994
; Modified by kam on Mon Nov 20 12:19:08 1995
; Written from MASE, from file "HIV1TAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
; Modified by adf on Sat Nov 9 17:38:25 1996
C_UG268A
%CAGGAAGTCAGCCTAAAACTCCTTGTACTAAGTGTTTTGGTAAAAAATGTAGTTATCATTGTCAAGTTT
GCTTTCTGAACAAAGGCTTAGGCATCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAACGCTCCTCC
AAGCAGTGAGGATCATCAAAATCTTATATCAAAGCAACCCTTACCCCAACCCCGAGGGGACCCGACAGGC
CCGGAGAAATCGAAGAAGAAGGTGGAGAGCAAGACAGAGACAGATCCGTGAGATTAA
; LOCUS HIVELI
;
; Modified by kam on Mon Jul 20 12:24:18 1992
; Modified by kxm on Fri Nov 4 12:15:17 1994
; Modified by kxm on Fri Nov 4 23:17:50 1994
; Modified by kam on Mon Nov 20 12:19:08 1995
; Written from MASE, from file "HIV1TAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
D_ELI
ATGGATCCAGTAGATCCTAACCTAGAGCCCTGGAACCATCCAGGAAGTCAGCCTAGGACTCCTTGTAACA
AGTGTCATTGTAAAAAGTGTTGCTATCATTGCCCAGTTTGCTTCTTAAACAAAGGCTTAGGCATCTCCTA
TGGCAGGAAGAAGCGGAGACAGCGACGAGGACCTCCTCAAGGCGGTCAGGCTCATCAAGTTCCTATACCA
AAGCAACCCTCCTCCCAGCCCCGAGGGGACCCGACAGGCCCGAAGGAACAGAAGAAGAAGGTGGAGAGCG
AGGCAGAGACAGATCCGTGAGATTGCTGA
; Region 70 to 290 stored
;
; Region 70 to 290, from file bz163a.mase-nuc
; Written from MASE, from file "HIV1TAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
F_BZ163A
ATGGAGCTAGTAGATCCTAACTTAGATCCCTGGAACCATCCAGGAAGCCAGCCTACAACTCCTTGTACAA
AATGCTATTGTAAACGATGTTGCTTTCATTGTCAATGGTGCTTTACAACGAAGGGCTTAGGCATCTCCTA
TGGCAGGAAGAAGCGGAAACAGCGGCACCGAACTCCTCAGAGCAGCCAGATACATCAAGATCTTGTACCA
AAGCAACCCATATCCCAAGCCCGAGGGAACCCGACAGGCCCGAAGAAATCGAAGAAGGAGGTGGAGAGCA
AGGCAGAGACAGATCCGTGAGATTAGTAG
; Modified by kam on Mon Jul 20 12:10:15 1992
; Modified by kxm on Fri Nov 4 12:15:17 1994
; Modified by kxm on Sat Nov 5 00:44:35 1994
; Modified by kam on Mon Nov 20 12:19:08 1995
; Written from MASE, from file "HIV1TAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
O_ANT70
ATGGATCCAGTAGATCCTGAGGTGCCCCCTTGGCACCACCCTGGAAGTCAGCCCCAGATCCCTTGTAATA
ATTGCTATTGCAAAAGATGCTGCTATCATTGCTATGTTTGTTTCGTAAGAAAGGGTTTGGGAATCTCCTA
TGGCAGGAAGAAGCGAGGACGACCAGCTGCTGCAAGCCATCCAGATCATAAAGATCCTGTACCAAAGCAA
TCCCCAACCATCACCAAGAGGAAGCAGGAACGCCAGGAAGAACAGGAGGAGGAGGTGGAGAAGAAGGCAG
GCCCAGGTGGATACCCTCGCCGCAAGGGTTCTTGCCACTGTTGTACACGGACCTCAGAACAA
;
; Modified by rkl on Wed Jun 30 09:36:11 1993
; Modified by kxm on Fri Nov 4 12:15:17 1994
; Modified by kxm on Sat Nov 5 00:44:35 1994
; Modified by kam on Mon Nov 20 12:19:08 1995
; Written from MASE, from file "HIV1TAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
O_MVP5180
ATGGATCCAGTAGATCCTGAGATGCCCCCTTGGCATCACCCTGGGAGCAAGCCCCAAACCCCTTGTAATA
ATTGCTATTGCAAAAGATGCTGCTATCATTGCTATGTTTGTTTCACAAAGAAGGGTTTGGGAATCTCCCA
TGGCAGGAAGAAGCGAAGAAGACCAGCAGCTGCTGCAAGCTATCCAGATAATAAAGATCCTGTACCAGAG
CAATCCCTGTCCCACACCGGCAGGAAGCAGAAACGCCAGGAAGAACAGGAGAAGAAGGTGGAGAAGGAGA
CAGGCCCAAGTGGACAGCCTTGCCACCAGGATTCTTGCAACAGTTGTACACGGATCTCAGGACAATAA
; LOCUS SIVCPZ
;
; Modified by kam on Fri Jul 17 11:13:21 1992
; Modified by kxm on Fri Nov 4 12:15:17 1994
; Modified by kxm on Fri Nov 4 23:12:24 1994
; Written from MASE, from file "HIV1TAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
CPZGAB
ATGGATCCAATAGATCCTGACCTGGAGCCCTGGAAACACCCAGGCAGTCAGCCAAGAACAGTTTGTAATA
ATTGCTATTGCAAAGCTTGTTGTTATCACTGTATATATTGCTTCACAAAAAAAGGCTTAGGAATCTCCTA
TGGCAGGAAGAAGCGAACCACAAGACGACGCACGGCTCCTGCAGGCAGTAAAAATAATCAAGATTCTATA
CCAAAGCAACCCTTATCCCAGTCCAGAGGGAACAAGGAAGGCTCGGAGAAATCGACGAAGGAGGTGGCGA
GCAAGACAGAAGCAGATCAGTGAGATTAG
;
; Modified by kxm on Fri Nov 4 12:15:17 1994
; Modified by kxm on Fri Nov 4 23:12:24 1994
; Modified by kxm on Fri Nov 4 23:58:34 1994
; Modified by acs on Mon Nov 27 10:24:48 1995
; Modified by kam on Thu Nov 30 09:43:33 1995
; Modified by bwb on Fri Dec 1 09:03:00 1995
; Written from MASE, from file "HIV1TAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
CPZANT
ATGGACCCCGTAGACGCTGAAACACCTCCATGGTTACACCCTCCTGCTACACCAGCAACGCCATGCAATA
ACTGTTACTGTAAATGCTGTTGTTACCATTGCCCTCTCTGCTTCACAAAAAAAGGCTTGGGGATTTCCTA
TGGCAGGAAGAGAAGAGCTCGAAGGAACAGACGAACAACTGCTGAAAGCAGTGAAAATAATCAAGATCCT
GTATCAAAATCCCTACCCAAAACCAGCAGGATCCAGAGCAGCCAGAAGAAATAAGAGAAGAAGGTGGAAG
AAAAGACAGGATCAGGTGGAGGGCCTTGC
;; Modified by cxc on Thu Oct 20 14:56:54 1994
; LOCUS HIV2ROD.nuc
;
; Modified by kam on Thu Jul 29 11:47:29 1993
; Modified by cxc on Fri Oct 28 14:37:09 1994
; Written from MASE, from file "HIV2SIVTAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
A_ROD
ATGGAGACACCCTTGAAGGCGCCAGAGAGCTCATTAAAGTCCTGCAACGAGCCCTTTTCACGCACTTCAG
AGCAGGATGTGGCCACTCAAGAATTGGCCAGACAAGGGGAGGAAATCCTCTCTCAGCTATACCGACCCCT
AGAAACATGCAATAACTCATGCTATTGTAAGCGATGCTGCTACCATTGTCAGATGTGTTTTCTAAACAAG
GGGCTCGGGATATGTTATGAACGAAAGGGCAGACGAAGAAGGACTCCAAAGAAAACTAAGACTCATCCGT
CTCCTACACCAGACAAATCCATATCCACAAGGACCGGGGACAGCCAGCCAACGAAGAAACAGAAGAAGAC
GGTGGAAGCAACGGTGGAGACAGATACTGGCCCTGGCCGA
;; Modified by bwb on Wed Sep 14 11:35:17 1994
; HIV2 (ISOLATE EHO) PROVIRUS NUCLEOCAPSID CORE PROTEIN (GAG)
; GENE, 3' END THROUGH THE 3' LTR.
; Modified by bwb on Wed Sep 14 11:35:17 1994
; Modified by bwb on Thu Sep 15 15:12:52 1994
; Written from MASE, from file "HIV2SIVTAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
B_EHOA
ATGGAAATACCCTTGAAGGAGCAGGAGAGCTCATTAAACTCCTCCAGCGGGCACTCTTCCTCCACTTCAG
AGGGGGTTGCCAACACTCAAGGATTGGACAACCGGGGGGAGGAAATCCTCTCTCAGCTATACCGCCCTCT
TAAGGCATGCAGTAATACATGCTACTGTAAAAAATGTTCCTACCATTGCCAGCTTTGCTTTCTTAAAAAG
GGCCTGGGGATATGTTATGAACGCTCGAGAAAGAGATCTTCAAAAAGGGCTAAGACTACTACATCTTCTG
CACCAAACAACAGATCCCTATCCGCAAGGACCGGGGACAGCCAGCCAACGAAGAAACAGAAGAAGGAGGT
GGAAACAACGAGGGCTACAGATCTTGGCCCTGGCAGATCGAATACATCCACTTCCCGATTCGCCAACTGA
; LOCUS SIVMM251.nuc
;
; Modified by kam on Wed Sep 2 10:04:14 1992
; Modified by cxc on Fri Oct 28 14:37:09 1994
; Written from MASE, from file "HIV2SIVTAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
D_MM251
ATGGAGACACCCTTGAGGGAGCAGGAGAACTCATTAGAATCCTCCAACGAGCGCTCTTCATGCATTTTAG
AGGCGGATGCAACCACTCCAGAATCGGCCAACCTGGGGGAGGAAATCCTCTCTCAACTATACCGCCCTCT
TGAGGCGTGCTATAACACATGCTATTGTAAAAAGTGTTGCTACCATTGCCAGTTTTGTTTTCTTAAAAAG
GGATTGGGGATATGTTATGAGCAGTCACGAAAGAGAAGAAGAACTCCGAAAAAGGCTAAGGCTAATACAT
CTTCTGCATCAAACAAACTCATACCCAACAGGACCCGGCACTGCCAACCAGAGAAGGCAAAGAAGGAGAC
GGTGGAGAAGGCGGTGGCAACAGCTCCTGGCCTTGGCAGA
; LOCUS SIVSTM.nuc
;
; Modified by kam on Wed Sep 2 10:04:14 1992
; Modified by cxc on Fri Oct 28 14:37:09 1994
; Written from MASE, from file "HIV2SIVTAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
STM_STM
ATGGAGACACCCTTGAAGGAGCAGGAGAGCTCATTAAGATCCTCCAGCGAGCCCTCTTCATGCACTTCAG
AGGCGGTTGCCGCCACTCCAGGATTGGCCAACCAGGAGGAGGAAATCCTTTGGCAACTATACCGCCCACT
AGAGGAGTGTTGTAACAAGTGCTTTTGCAAAAAATGTTGCTATCACTGCCAGCTGTGTTTTGTTACAAAA
GGTCTTGGAATAACCTATGAGCGATCAAGAAGAAGAGTTAAGAAAAAGGCTAAGACTTATCCAATTTCTG
CATCAAACAACAGATCCCTATCCACAAGGGCCAGGAACAGCCAACCAAAGAAGGAACAGAAGAAGGAGGT
GGAGACAGAGGTGGAATCAACTCCTGGCCTTGGCAAA
;; Modified by rkl on Mon Apr 19 10:38:05 1993
;; Modified by rkl on Mon Apr 19 10:30:34 1993
; LOCUS SIVAGM3
;
; Modified by rkl on Mon Apr 19 10:30:34 1993
; Modified by adf on Wed Oct 19 13:36:17 1994
; Modified by adf on Wed Oct 19 13:40:23 1994
; Written from MASE, from file "AGMTAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
VER_AGM3
ATGGACAAGGGGGAGGACGAGCAGGGCGCGTACCACCAGGACTTGATTGAACAACTCAAAGCACCCCTGA
AGCGGTGTACAAACAAGTGCTATTGTAAATGTTGCTGTTATCACTGTCAGCTTTGCTTTTTACAAAAGGG
ATTAGGTGTTACCTATCATGCCCCTAGGATCAGAAGAAAGAAGATTGCTCCGCTTGATCGCTTTCCTGAA
CAAAAACAATCCATATCCACCCGTGGAAGGGACAGCCAGACAACGCAGAAGGGCCAGGAGAAGGTGGAGA
CAAGCGCAAGAACAGCTCCGAGCCTTGGCAGAAAGAATCTGGCACAGCAGAGTGGAAGAGCAACTGGTGC
AAGC
;
; LOCUS SIVAGM677
;
; Modified by rkl on Mon Apr 19 10:30:34 1993
; Modified by rkl on Mon Apr 19 10:38:05 1993
; Modified by adf on Wed Oct 19 13:36:17 1994
; Modified by adf on Wed Oct 19 13:40:23 1994
; Written from MASE, from file "AGMTAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
GRI_AGM677
ATGGACAAGGAGGAGGAGCCCCACCCCCTCCTCCAGGACTTGCATAGGCCATTACAACCATGTACTAATA
AATGCTATTGCAAAAAATGCTGTTATCACTGTGAGCTTTGCTTCCTGCAGAAGGGCTTAGGAGTGCGTTA
TCATGTCTCTAGGAAAAGAAGAAAAACAAGCACTCAAGATAATCAAGACCCTATACGGCAGCAATCCATA
TCCACAGTTCAGCGGAACGGCCAGACAACGGAGGAGGGCAAGACAGAGGTGGAG
;
; LOCUS SIVAGMSAB
;
; Modified by rkl on Mon Apr 19 10:30:34 1993
; Modified by rkl on Mon Apr 19 10:38:05 1993
; Modified by adf on Wed Oct 19 13:36:17 1994
; Modified by adf on Wed Oct 19 13:40:23 1994
; Written from MASE, from file "AGMTAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
SAB_SAB1C
ATGGACCAGGAGCAGGAGGCCCGCCCCCAGGTCTGGGAGGAGCTTCAGGAGGAGCTGCATCGGCCGCTCC
AGGCCTGTGATAATACTTGCTTCTGCAAAGTTTGCTGCTTTCATTGTATTCTCTGCTTCCATAAAAAGGC
CCTAGGCATTCGCTATTATGTCCCTAGGCCAAGAAGAGCTTCTAAGAAGATTTCGCATAATCAAGTTTCT
CTACACAAC
;
; LOCUS SIVSYK
;
; Modified by rkl on Mon Apr 19 10:30:34 1993
; Modified by rkl on Mon Apr 19 10:38:05 1993
; Modified by adf on Wed Oct 19 13:36:17 1994
; Modified by adf on Wed Oct 19 13:40:23 1994
; Modified by kam on Mon Feb 5 11:31:14 1996
; Written from MASE, from file "AGMTAT.mase-nuc"
; Modified by adf on Sat Nov 9 16:27:39 1996
SYK_SYK
ATGTCCTCAACGGACCAGATATGCCAGACACAGAGGGTACCCCCATCCTTCTTAGAAGGAACATTCCTAG
AGAAAGGACCACCAACACCATGTAATAAATGCTTTTGCAAAAACTGTTGCTATCATTGCCAGCTTTGTTT
CCTTCAAAAGGGATTGGGAATCACTTATGCCAGACCAAGGAAGCGAGCAGCTCGCAGTATTTCTGAGGAT
GATAGCGCACCTACAGGAACCCTACCCAGGGCCGGAAGGACCCAGGCAAACCCGCAGACGAAGAAGAAGG
CAGTGGAGACAGAGAAGGACTCAACGTCTCTACCTTCAGCAGAGAATCTT
Jump to Line
Something went wrong with that request. Please try again.