add option for 1-based coords when using Fasta.sequence refs #1

README.rst

@@ -42,14 +42,18 @@ Slicing
     >>> f['chr1'][::3]
     'AGTCAGTCAGTCAGTCAGTCAGTCAGT'
 
-    # can query by a 'feature' dictionary
+    # can query by a 'feature' dictionary (note this is one based coordinates)
     >>> f.sequence({'chr': 'chr1', 'start': 2, 'stop': 9})
     'CTGACTGA'
 
     # same as:
     >>> f['chr1'][1:9]
     'CTGACTGA'
 
+    # use python, zero based coords
+    >>> f.sequence({'chr': 'chr1', 'start': 2, 'stop': 9}, one_based=False)
+    'TGACTGA'
+
     # with reverse complement (automatic for - strand)
     >>> f.sequence({'chr': 'chr1', 'start': 2, 'stop': 9, 'strand': '-'})
     'TCAGTCAG'

pyfasta/fasta.py

@@ -114,7 +114,7 @@ def __getitem__(self, i):
         return self.chr[i]
 
     def sequence(self, f, asstring=True, auto_rc=True
-            , exon_keys=None):
+            , exon_keys=None, one_based=True):
         """
         take a feature and use the start/stop or exon_keys to return
         the sequence from the assocatied fasta file:
@@ -123,6 +123,8 @@ def sequence(self, f, asstring=True, auto_rc=True
                 : if false, return as a numpy array
         auto_rc : if True and the strand of the feature == -1, return
                   the reverse complement of the sequence
+        one_based: if true, query is using 1 based closed intervals, if false
+                    semi-open zero based intervals
 
             >>> from pyfasta import Fasta
             >>> f = Fasta('tests/data/three_chrs.fasta')
@@ -183,7 +185,8 @@ def sequence(self, f, asstring=True, auto_rc=True
             sequence = self._seq_from_keys(f, fasta, exon_keys)
 
         if sequence is None:
-            sequence = fasta[(f['start'] - 1): f['stop']]
+            start = (f['start'] - 1) if one_based else f['start'] 
+            sequence = fasta[start: f['stop']]
 
         if auto_rc and f.get('strand') in (-1, '-1', '-'):
             sequence = complement(sequence)[::-1]