add summarize-alignment visualizer (#2)

caporaso-lab · Apr 2, 2024 · 1e802ea · 1e802ea
1 parent e54d743
commit 1e802ea
Show file tree

Hide file tree

Showing 3 changed files with 86 additions and 0 deletions.
diff --git a/q2_dwq2/_visualizers.py b/q2_dwq2/_visualizers.py
@@ -0,0 +1,41 @@
+# ----------------------------------------------------------------------------
+# Copyright (c) 2024, Greg Caporaso.
+#
+# Distributed under the terms of the Modified BSD License.
+#
+# The full license is in the file LICENSE, distributed with this software.
+# ----------------------------------------------------------------------------
+
+import os.path
+
+from skbio.alignment import TabularMSA
+
+
+def summarize_alignment(output_dir: str, msa: TabularMSA) -> None:
+    with open(os.path.join(output_dir, "index.html"), "w") as fh:
+        fh.write(_html_template % repr(msa))
+
+
+_html_template = """
+<!DOCTYPE html>
+<html lang="en">
+<head>
+    <meta charset="UTF-8">
+    <meta name="viewport" content="width=device-width, initial-scale=1.0">
+    <title>Alignment summary</title>
+    <style>
+        body {
+            padding: 20px;
+        }
+        p.alignment {
+            font-family: 'Courier New', Courier, monospace;
+        }
+    </style>
+</head>
+<body>
+    <pre>
+%s
+    </pre>
+</body>
+</html>
+"""
diff --git a/q2_dwq2/plugin_setup.py b/q2_dwq2/plugin_setup.py
@@ -10,6 +10,7 @@
 from q2_types.feature_data import FeatureData, Sequence, AlignedSequence
 from q2_dwq2 import __version__
 from q2_dwq2._methods import nw_align
+from q2_dwq2._visualizers import summarize_alignment
 
 citations = Citations.load("citations.bib", package="q2_dwq2")
 
@@ -54,3 +55,13 @@
                  "This action is for demonstration purposes only. 🐌"),
     citations=[citations['Needleman1970']]
 )
+
+plugin.visualizers.register_function(
+    function=summarize_alignment,
+    inputs={'msa': FeatureData[AlignedSequence]},
+    input_descriptions={'msa': 'The multiple sequence alignment to summarize.'},
+    parameters={},
+    parameter_descriptions={},
+    name='Summarize an alignment.',
+    description='Summarize a multiple sequence alignment.',
+)
diff --git a/q2_dwq2/tests/test_visualizers.py b/q2_dwq2/tests/test_visualizers.py
@@ -0,0 +1,34 @@
+# ----------------------------------------------------------------------------
+# Copyright (c) 2024, Greg Caporaso.
+#
+# Distributed under the terms of the Modified BSD License.
+#
+# The full license is in the file LICENSE, distributed with this software.
+# ----------------------------------------------------------------------------
+
+import os.path
+
+from skbio.alignment import TabularMSA
+from skbio.sequence import DNA
+
+from qiime2.plugin.testing import TestPluginBase
+
+from q2_dwq2._visualizers import summarize_alignment
+
+
+class SummarizeAlignmentTests(TestPluginBase):
+    package = 'q2_dwq2.tests'
+
+    def test_simple1(self):
+        aligned_sequence1 = DNA('AAAAAAAAGGTGGCCTTTTTTTT')
+        aligned_sequence2 = DNA('AAAAAAAAGG-GGCCTTTTTTTT')
+        msa = TabularMSA([aligned_sequence1, aligned_sequence2])
+
+        with self.temp_dir as output_dir:
+            summarize_alignment(output_dir, msa)
+
+            with open(os.path.join(output_dir, 'index.html'), 'r') as fh:
+                observed = fh.read()
+
+            self.assertIn('AAAAAAAAGGTGGCCTTTTTTTT', observed)
+            self.assertIn('AAAAAAAAGG-GGCCTTTTTTTT', observed)