Fix the 3’ rule on a trailing sub-sequence

[totakke]

I have fixed the missing consideration to the 3’ rule on a trailing sub-sequence.

The current 3’ rule of varity does not consider a trailing sub sequence. For example, {:pos 1, :ref "C", :alt "CAT"} insertion to CATA sequence (result: CATATA) is normalized to {:pos 3, :ref "T", :alt "TAT"}. In this case, however, A trails after the inserted bases which is a substring of the insertions AT, so {:pos 4, :ref "A", :alt "ATA"} insertion to CATA also returns the same result (CATATA). The fixed 3’ rule in this PR can consider the trailing sub-sequence.

This PR includes and passes #62 test cases.

(require '[varity.vcf-to-hgvs :refer :all :as v2h])

(v2h/vcf-variant->hgvs
 {:chr "chr20", :pos 58854572, :ref "CCGCCCCAGCCGATCCCGACTCCGGGGCGGCCCCTGA", :alt "C"}
 "path/to/hg38.fa" "path/to/refGene.txt.gz" {:prefer-deletion? true})
;;=> ({:coding-dna #clj-hgvs/hgvs "NM_016592:c.*42+13738_*42+13773delCGACTCCGGGGCGGCCCCTGACGCCCCAGCCGATCC",
;;     :protein nil}
;;    {:coding-dna #clj-hgvs/hgvs "NM_001309861:c.-39+12749_-39+12784delCGACTCCGGGGCGGCCCCTGACGCCCCAGCCGATCC",
;;     :protein nil}
;;    {:coding-dna #clj-hgvs/hgvs "NM_001309883:c.1172_1207delCGACTCCGGGGCGGCCCCTGACGCCCCAGCCGATCC",
;;     :protein #clj-hgvs/hgvs "p.P391_I402del"}
;;    {:coding-dna #clj-hgvs/hgvs "NM_001077490:c.1172_1207delCGACTCCGGGGCGGCCCCTGACGCCCCAGCCGATCC",
;;     :protein #clj-hgvs/hgvs "p.P391_I402del"}
;;    {:coding-dna #clj-hgvs/hgvs "NM_080425:c.1359_1394delCGACTCCGGGGCGGCCCCTGACGCCCCAGCCGATCC",
;;     :protein #clj-hgvs/hgvs "p.S455_D466del"})

I confirmed lein test :all passed, but the answer values of some existing test cases were changed along with this fix. You need to be careful about that.

[codecov]

Codecov Report

Merging #63 (e0106e7) into master (4e42341) will decrease coverage by 0.01%.
The diff coverage is 43.13%.

@@            Coverage Diff             @@
##           master      #63      +/-   ##
==========================================
- Coverage   45.64%   45.63%   -0.02%     
==========================================
  Files          16       16              
  Lines        1974     1992      +18     
  Branches       60       63       +3     
==========================================
+ Hits          901      909       +8     
- Misses       1013     1020       +7     
- Partials       60       63       +3     

Impacted Files	Coverage Δ
src/varity/vcf_to_hgvs/protein.clj	27.66% <0.00%> (-0.49%)	⬇️
src/varity/vcf_to_hgvs/common.clj	65.83% <68.75%> (+0.06%)	⬆️

Help us with your feedback. Take ten seconds to tell us how you rate us. Have a feature suggestion? Share it here.

[totakke]

Fix the VCF variant and HGVS for rs55740729.

[totakke]

c.5_7dup and c.-145_-143dup correspond to rs3839049.

[totakke]

migrated from #62, but the order is fixed.

[totakke]

migrated from #62, but missing p.P391_I402del is added.

[nokara26]

Thank you for the fix! LGTM👍🏻

[federkasten]

LGTM 🙆‍♂️