-
Notifications
You must be signed in to change notification settings - Fork 53
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Merge pull request #384 from ChristopherBradley/377
Refactored parse.gff
- Loading branch information
Showing
5 changed files
with
54 additions
and
7 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,12 @@ | ||
##gff-version 2 | ||
##source-version <source> <version text> | ||
##date <date> | ||
##Type <type> [<seqname>] | ||
##DNA <seqname> | ||
##acggctcggattggcgctggatgatagatcagacgac | ||
##... | ||
##end-DNA | ||
seq1 BLASTX similarity 101 235 87.1 + 0 Target "HBA_HUMAN" 11 55 ; E_value 0.0003 | ||
dJ102G20 GD_mRNA coding_exon 7105 7201 . - 2 Sequence "dJ102G20.C1.1" | ||
dJ102G20 GD_mRNA coding_exon 7105 7201 . - 2 | ||
12345 Source with spaces feature with spaces -100 3600000000 1e-5 - . Sequence "BROADO5" ; Note "This is a \t tab containing \n multi line comment" |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters