Merge pull request #384 from ChristopherBradley/377

Refactored parse.gff

src/cogent3/core/alignment.py

@@ -64,7 +64,7 @@
 from cogent3.format.nexus import nexus_from_alignment
 from cogent3.format.phylip import alignment_to_phylip
 from cogent3.maths.stats.number import CategoryCounter
-from cogent3.parse.gff import GffParser, parse_attributes
+from cogent3.parse.gff import gff2_parser, parse_attributes
 from cogent3.util import progress_display as UI
 from cogent3.util.dict_array import DictArrayTemplate
 from cogent3.util.misc import (
@@ -1135,7 +1135,7 @@ def annotate_from_gff(self, f):
             frame,
             attributes,
             comments,
-        ) in GffParser(f):
+        ) in gff2_parser(f):
             if name in self.named_seqs:
                 self.named_seqs[name].add_feature(
                     feature, parse_attributes(attributes), [(start, end)]

src/cogent3/core/sequence.py

@@ -749,7 +749,7 @@ def annotate_from_gff(self, f):
             frame,
             attributes,
             comments,
-        ) in gff.GffParser(f):
+        ) in gff.gff2_parser(f):
             if first_seqname is None:
                 first_seqname = seqname
             else:

src/cogent3/parse/gff.py

@@ -2,15 +2,37 @@
 
 __author__ = "Peter Maxwell"
 __copyright__ = "Copyright 2007-2019, The Cogent Project"
-__credits__ = ["Peter Maxwell", "Matthew Wakefield", "Gavin Huttley"]
+__credits__ = [
+    "Peter Maxwell",
+    "Matthew Wakefield",
+    "Gavin Huttley",
+    "Christopher Bradley",
+]
 __license__ = "BSD-3"
 __version__ = "2019.10.24a"
 __maintainer__ = "Peter Maxwell"
 __email__ = "pm67nz@gmail.com"
 __status__ = "Production"
 
+from io import StringIO
+from pathlib import Path
 
-def GffParser(f):
+from cogent3.util.misc import open_
+
+
+def gff_parser(f):
+    """delegates to the correct gff_parser based on the version"""
+    f = f if not isinstance(f, Path) else str(f)
+    if isinstance(f, str):
+        with open_(f) as infile:
+            yield from gff2_parser(infile)
+    elif isinstance(f, StringIO):
+        yield from gff2_parser(f)
+    else:
+        raise TypeError
+
+
+def gff2_parser(f):
     assert not isinstance(f, str)
     for line in f:
         # comments and blank lines

tests/data/gff2_test.gff

@@ -0,0 +1,12 @@
+##gff-version 2
+##source-version <source> <version text>
+##date <date>
+##Type <type> [<seqname>]
+##DNA <seqname>
+##acggctcggattggcgctggatgatagatcagacgac
+##...
+##end-DNA
+seq1	BLASTX	similarity	101	235	87.1	+	0	Target "HBA_HUMAN" 11 55 ; E_value 0.0003
+dJ102G20	GD_mRNA	coding_exon	7105	7201	.	-	2	Sequence "dJ102G20.C1.1"
+dJ102G20	GD_mRNA	coding_exon	7105	7201	.	-	2
+12345	Source with spaces	feature with spaces	-100	3600000000	1e-5	-	.	Sequence "BROADO5" ; Note "This is a \t tab containing \n multi line comment"

tests/test_parse/test_gff.py

@@ -2,6 +2,7 @@
 """Unit tests for GFF and related parsers.
 """
 from io import StringIO
+from pathlib import Path
 from unittest import TestCase, main
 
 from cogent3.parse.gff import *
@@ -92,14 +93,14 @@ class GffTest(TestCase):
     def testGffParserData(self):
         """Test GffParser with valid data lines"""
         for (line, canned_result) in data_lines:
-            result = next(GffParser(StringIO(line)))
+            result = next(gff_parser(StringIO(line)))
             self.assertEqual(result, canned_result)
 
     def testGffParserHeaders(self):
         """Test GffParser with valid data headers"""
         data = "".join([x[0] for x in data_lines])
         for header in headers:
-            result = list(GffParser(StringIO(header + data)))
+            result = list(gff_parser(StringIO(header + data)))
             self.assertEqual(result, [x[1] for x in data_lines])
 
     def test_parse_attributes(self):
@@ -109,6 +110,18 @@ def test_parse_attributes(self):
             ["HBA_HUMAN", "dJ102G20.C1.1", "", "BROADO5"],
         )
 
+    def test_gff2_parser_string(self):
+        """Test the gff_parser works with a string filepath"""
+        filepath = "data/gff2_test.gff"
+        for i, result in enumerate(gff_parser(filepath)):
+            self.assertEqual(result, data_lines[i][1])
+
+    def test_gff2_parser_path(self):
+        """Test the gff_parser works with a pathlib.Path filepath"""
+        filepath = Path("data/gff2_test.gff")
+        for i, result in enumerate(gff_parser(filepath)):
+            self.assertEqual(result, data_lines[i][1])
+
 
 if __name__ == "__main__":
     main()