-
Notifications
You must be signed in to change notification settings - Fork 295
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Merge pull request #1831 from dib-lab/khmer_saghi
Saghi cms unique kmers
- Loading branch information
Showing
4 changed files
with
29 additions
and
3 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,25 @@ | ||
#!/usr/bin/env python | ||
# The following program uses khmer to | ||
# find unique kmers to only one sequence. | ||
import khmer | ||
d1 = "ATGTACGGGCATTACGATTACCGATGTAG" | ||
d2 = "ATGACCAAACTCATTACGATTAGATATAG" | ||
ksize = 5 | ||
target_table_size = 5e5 | ||
num_tables = 4 | ||
bf = khmer.Nodetable(ksize, target_table_size, num_tables) | ||
bf.consume(d1) | ||
cms = khmer.Counttable(ksize, target_table_size, num_tables) | ||
for kmer in cms.get_kmers(d2): | ||
if bf.get(kmer) == 0: | ||
cms.consume(kmer) | ||
|
||
# If kmer is in both sequences it should not be in cms but in bf | ||
assert cms.get('CATTA') == 0 | ||
assert bf.get('CATTA') > 0 | ||
# If kmer is in d1 but not d2 it should not be in cms but be in bf | ||
assert cms.get('ATGTA') == 0 | ||
assert bf.get('ATGTA') > 0 | ||
# If kmer is in d2 but not d1 it should be in cms and not in bf | ||
assert cms.get('TATAG') > 0 | ||
assert bf.get('TATAG') == 0 |