Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Macro(Import FASTA): The ' * ' symbol occurring between two letters is not recognized as a break in peptide chain #1849

Closed
Zhirnoff opened this issue Mar 19, 2024 · 1 comment · Fixed by #1859 or #1862
Assignees
Labels

Comments

@Zhirnoff
Copy link
Collaborator

Zhirnoff commented Mar 19, 2024

Steps to Reproduce

  1. Switch to Macro mode
  2. Paste FASTA sequence with '*' between two letters and in the end (Not right away, but one by one)
>M18404.1 Human IgG2 lambda antibody (1B8.env reactive) gp41 coding region DNA
GCAGTGGGAAGAGGAGCTTTGTTCCTTGGGTTCT*TGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAA
>M18404.1 Human IgG2 lambda antibody (1B8.env reactive) gp41 coding region DNA
GCAGTGGGAAGAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAA*

Actual behavior
The ' * ' symbol occurring between two letters is not recognized as a break in peptide chain

Expected behavior
The ' * ' symbol occurring between two letters is recognized as a break in peptide chain (no bond should be created between monomers separated with the ""). "" means the end of the peptide sequence
#1755

Desktop (please complete the following information):

  • OS: Windows 11
  • Browser Chrome
  • Version 112.0.5615.138 (Official Build) (64-bit)

Indigo version
[Version 1.19.0-rc.1]

Attachments
2024-03-19_16h24_47
2024-03-19_16h27_10
2024-03-19_16h27_17

@Zhirnoff Zhirnoff added epic: macromolecules FASTA Bucket: FASTA related issues labels Mar 19, 2024
@Zhirnoff Zhirnoff added this to the Indigo-1.19.0-rc.2 milestone Mar 19, 2024
even1024 added a commit that referenced this issue Mar 21, 2024
…ters is not recognized as a break in peptide chain (#1859)
even1024 added a commit that referenced this issue Mar 21, 2024
…ters is not recognized as a break in peptide chain (#1859)
even1024 added a commit that referenced this issue Mar 22, 2024
…een two letters is not recognized as a break in peptide chain (#1862)
@AlexeyGirin
Copy link
Collaborator

Fixed.
image

  • Indigo Toolkit Version 1.19.0-rc.2.0-g6c0e3fecf-x86_64-linux-gnu-11.2.1
  • Ketcher Version 2.20.0-rc2 Build at 2024-03-27; 08:30:51
  • Chrome Version 122.0.6261.70 (Official Build) (64-bit)
  • Win10

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment