You signed in with another tab or window. Reload to refresh your session.You signed out in another tab or window. Reload to refresh your session.You switched accounts on another tab or window. Reload to refresh your session.Dismiss alert
Paste FASTA sequence with '*' between two letters and in the end (Not right away, but one by one)
>M18404.1 Human IgG2 lambda antibody (1B8.env reactive) gp41 coding region DNA
GCAGTGGGAAGAGGAGCTTTGTTCCTTGGGTTCT*TGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAA
>M18404.1 Human IgG2 lambda antibody (1B8.env reactive) gp41 coding region DNA
GCAGTGGGAAGAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAA*
Actual behavior
The ' * ' symbol occurring between two letters is not recognized as a break in peptide chain
Expected behavior
The ' * ' symbol occurring between two letters is recognized as a break in peptide chain (no bond should be created between monomers separated with the ""). "" means the end of the peptide sequence #1755
Desktop (please complete the following information):
OS: Windows 11
Browser Chrome
Version 112.0.5615.138 (Official Build) (64-bit)
Indigo version
[Version 1.19.0-rc.1]
Attachments
The text was updated successfully, but these errors were encountered:
Steps to Reproduce
Actual behavior
The ' * ' symbol occurring between two letters is not recognized as a break in peptide chain
Expected behavior
The ' * ' symbol occurring between two letters is recognized as a break in peptide chain (no bond should be created between monomers separated with the ""). "" means the end of the peptide sequence
#1755
Desktop (please complete the following information):
Indigo version
[Version 1.19.0-rc.1]
Attachments
The text was updated successfully, but these errors were encountered: