Remove last remnants of Seq.tostring and deprecate it

Bio/Seq.py

@@ -292,16 +292,14 @@ def __radd__(self, other):
             raise TypeError
 
     def tostring(self):                            # Seq API requirement
-        """Returns the full sequence as a python string (semi-obsolete).
-
-        Although not formally deprecated, you are now encouraged to use
-        str(my_seq) instead of my_seq.tostring()."""
-        #TODO - Fix all places elsewhere in Biopython using this method,
-        #then start deprecation process?
-        #import warnings
-        #warnings.warn("This method is obsolete; please use str(my_seq) "
-        #              "instead of my_seq.tostring().",
-        #              PendingDeprecationWarning)
+        """Returns the full sequence as a python string (DEPRECATED).
+
+        You are now encouraged to use str(my_seq) instead of
+        my_seq.tostring()."""
+        import warnings
+        warnings.warn("This method is obsolete; please use str(my_seq) "
+                      "instead of my_seq.tostring().",
+                      PendingDeprecationWarning)
         return str(self)
 
     def tomutable(self):   # Needed?  Or use a function?
@@ -1722,7 +1720,7 @@ def count(self, sub, start=0, end=sys.maxsize):
         """
         try:
             #TODO - Should we check the alphabet?
-            search = sub.tostring()
+            search = str(sub)
         except AttributeError:
             search = sub
 
@@ -1738,7 +1736,7 @@ def count(self, sub, start=0, end=sys.maxsize):
             return count
         else:
             #TODO - Can we do this more efficiently?
-            return self.tostring().count(search, start, end)
+            return str(self).count(search, start, end)
 
     def index(self, item):
         for i in range(len(self.data)):
@@ -1801,10 +1799,10 @@ def extend(self, other):
                 self.data.append(c)
 
     def tostring(self):
-        """Returns the full sequence as a python string (semi-obsolete).
+        """Returns the full sequence as a python string (DEPRECATED).
 
-        Although not formally deprecated, you are now encouraged to use
-        str(my_seq) instead of my_seq.tostring().
+        You are now encouraged to use str(my_seq) instead of my_seq.tostring()
+        as this method is officially deprecated.
 
         Because str(my_seq) will give you the full sequence as a python string,
         there is often no need to make an explicit conversion.  For example,
@@ -1815,6 +1813,10 @@ def tostring(self):
 
         print("ID={%s}, sequence={%s}" % (my_name, my_seq.tostring()))
         """
+        import warnings
+        warnings.warn("This method is obsolete; please use str(my_seq) "
+                      "instead of my_seq.tostring().",
+                      PendingDeprecationWarning)
         return "".join(self.data)
 
     def toseq(self):

BioSQL/BioSeq.py

@@ -101,10 +101,14 @@ def __getitem__(self, index):                 # Seq API requirement
             return Seq(full[::index.step], self.alphabet)
 
     def tostring(self):
-        """Returns the full sequence as a python string.
-
-        Although not formally deprecated, you are now encouraged to use
-        str(my_seq) instead of my_seq.tostring()."""
+        """Returns the full sequence as a python string (DEPRECATED).
+
+        You are now encouraged to use str(my_seq) instead of
+        my_seq.tostring()."""
+        import warnings
+        warnings.warn("This method is obsolete; please use str(my_seq) "
+                      "instead of my_seq.tostring().",
+                      PendingDeprecationWarning)
         return self.adaptor.get_subseq_as_string(self.primary_id,
                                                  self.start,
                                                  self.start + self._length)

DEPRECATED

@@ -22,6 +22,11 @@ Python 3.0, 3.1, 3.2
 Never officially supported, these trigger a warning in Release 1.62
 recommending Python 3.3 or later if you wish to use Python 3.
 
+Bio.Seq.Seq.tostring() and Bio.Seq.MutableSeq.tostring()
+========================================================
+Deprecated as of Release 1.64. You should now use str(Bio.Seq.Seq) or
+str(Bio.Seq.MutableSeq) instead of the tostring() methods.
+
 Iterator .next() methods
 ========================
 The .next() method defined for any Biopython iterator is deprecated as of

Doc/Tutorial.tex

@@ -298,7 +298,7 @@ \section{Frequently Asked Questions (FAQ)}
   You need Biopython 1.54 or later, or just wrap the item with \verb|[...]| to create a list of one element.
 
   \item \emph{Why doesn't} \verb|str(...)| \emph{give me the full sequence of a} \verb|Seq| \emph{object?} \\
-  You need Biopython 1.45 or later.  Alternatively, rather than \verb|str(my_seq)|, use \verb|my_seq.tostring()| (which will also work on recent versions of Biopython).
+  You need Biopython 1.45 or later.
 
   \item \emph{Why doesn't} \verb|Bio.Blast| \emph{work with the latest plain text NCBI blast output?} \\
   The NCBI keep tweaking the plain text output from the BLAST tools, and keeping our parser up to date is/was an ongoing struggle.
@@ -744,13 +744,9 @@ \section{Turning Seq objects into strings}
 string from a \verb|SeqRecord| object, while the more general topic of reading and
 writing FASTA format sequence files is covered in Chapter~\ref{chapter:Bio.SeqIO}.
 
-\emph{NOTE:} If you are using Biopython 1.44 or older, using \verb|str(my_seq)|
-will give just a truncated representation.  Instead use \verb|my_seq.tostring()|
-(which is still available in the current Biopython releases for backwards compatibility):
-
 %cont-doctest
 \begin{verbatim}
->>> my_seq.tostring()
+>>> str(my_seq)
 'GATCGATGGGCCTATATAGGATCGAAAATCGC'
 \end{verbatim}
 
@@ -13246,8 +13242,9 @@ \subsection{Searching for instances}
 The simplest way to find instances, is to look for exact matches of
 the true instances of the motif:
 \begin{verbatim}
+<<<<<<< HEAD
 >>> for pos, seq in m.search_instances(test_seq):
-...     print(pos, seq.tostring())
+...     print("%i %s" % (pos, seq))
 ... 
 10 TATAA
 15 TATAA
@@ -13256,7 +13253,7 @@ \subsection{Searching for instances}
 We can do the same with the reverse complement (to find instances on the complementary strand):
 \begin{verbatim}
 >>> for pos, seq in m.reverse_complement().search_instances(test_seq):
-...     print(pos, seq.tostring())
+...     print("%i %s" % (pos, seq))
 ... 
 12 TAATA
 20 TTATA

Doc/cookbook/motif/motif.tex

@@ -276,7 +276,7 @@ \subsection{Searching for instances}
 the true instances of the motif:
 \begin{verbatim}
 >>> for pos,seq in m.search_instances(test_seq):
-...     print pos,seq.tostring()
+...     print pos, str(seq)
 ... 
 10 TATAA
 15 TATAA
@@ -285,7 +285,7 @@ \subsection{Searching for instances}
 We can do the same with the reverse complement (to find instances on the complementary strand):
 \begin{verbatim}
 >>> for pos,seq in m.reverse_complement().search_instances(test_seq):
-...     print pos,seq.tostring()
+...     print pos, str(seq)
 ... 
 12 TAATA
 20 TTATA

Tests/test_Seq_objs.py

@@ -304,12 +304,6 @@ def test_str_getitem(self):
                             self.assertEqual(str(example1[i:j:step]),
                                              str1[i:j:step])
 
-    def test_tostring(self):
-        """Check str(obj) and obj.tostring() match."""
-        for example1 in self._examples:
-            str1 = str(example1)
-            self.assertEqual(example1.tostring(), str1)
-
     def test_tomutable(self):
         """Check obj.tomutable() method."""
         for example1 in self._examples: