boum ### vs ### error when running blastn2snp

[heh30]

[~]>java -jar /usr/local/jvarkit/dist/blastn2snp.jar < /main/data/tmp/infilem7.out |column -t
[main] INFO jvarkit - Starting JOB at Tue May 03 16:16:59 PDT 2016 com.github.lindenb.jvarkit.tools.blast.BlastNToSnp version=undefined built=2016-05-03:11-05-55
[main] INFO jvarkit - Command Line args : (EMPTY/NO-ARGS)
[main] INFO jvarkit - Executing as hhough@compute2 on Linux 3.2.0-89-generic amd64; Java HotSpot(TM) 64-Bit Server VM 1.8.0_77-b03
[main] INFO jvarkit - Reading from stdin
[main] INFO jvarkit - resolveEntity:-//NCBI//NCBI BlastOutput/EN/http://www.ncbi.nlm.nih.gov/dtd/NCBI_BlastOutput.dtd/null
java.lang.IllegalStateException: boum 406 vs 1
at com.github.lindenb.jvarkit.tools.blast.BlastNToSnp.run(BlastNToSnp.java:282)
at com.github.lindenb.jvarkit.tools.blast.BlastNToSnp.call(BlastNToSnp.java:338)
at com.github.lindenb.jvarkit.tools.blast.AbstractBlastNToSnp.call(AbstractBlastNToSnp.java:274)
at com.github.lindenb.jvarkit.tools.blast.AbstractBlastNToSnp.call(AbstractBlastNToSnp.java:32)
at com.github.lindenb.jvarkit.util.command.Command.instanceMainWithExceptions(Command.java:549)
at com.github.lindenb.jvarkit.util.command.Command.instanceMain(Command.java:586)
at com.github.lindenb.jvarkit.util.command.Command.instanceMainWithExit(Command.java:592)
at com.github.lindenb.jvarkit.tools.blast.BlastNToSnp.main(BlastNToSnp.java:357)

query hit hit-index hsp-index query-POS hit-POS STRAND REF(hit) ALT(query) blast.align_length blast.hit.var blast.query.var blast.mid. var

[main] ERROR jvarkit - boum 406 vs 1
scaffold_1:46694924 Pp01 1 1 304 43120910 + C Y 203 C Y .
[main] ERROR jvarkit - Command failed

java version "1.8.0_77"
$JAVA_HOME : /usr/local/java
Ubuntu 12.04

I'm unsure why the boum error is being thrown. We've tried to use different input files and the result is the same, though the values for boum and vs differ. Is something missing that is causing this?

[lindenb]

can some lines of /main/data/tmp/infilem7.out please ?
That will be very hard to debug without seeing the content of the XML file.

[heh30]

Of course; let me know if you need more than this.

blastn blastn 2.2.24 [Aug-08-2010] ~Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, ~Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), ~"Gapped BLAST and PSI-BLAST: a new generation of protein database search~programs", Nucleic Acids Res. 25:3389-3402. Prunus_persica_v2.0.a1_scaffolds.fasta.Pp01 lcl|1_0 scaffold_1:46694924 203 1e-06 1 -3 5 2 F 1 lcl|1_0 scaffold_1:46694924 203 1 gnl|BL_ORD_ID|0 Pp01 0 47851208

Regards,
Heidi

From: Pierre Lindenbaum [mailto:notifications@github.com]
Sent: Tuesday, May 3, 2016 11:02 PM
To: lindenb/jvarkit jvarkit@noreply.github.com
Cc: Hough, Heidi heidi.hough@wsu.edu; Author author@noreply.github.com
Subject: Re: [lindenb/jvarkit] boum ### vs ### error when running blastn2snp (#51)

can I see the first lines of /main/data/tmp/infilem7.out please ?

—
You are receiving this because you authored the thread.
Reply to this email directly or view it on GitHubhttps://urldefense.proofpoint.com/v2/url?u=https-3A__github.com_lindenb_jvarkit_issues_51-23issuecomment-2D216752460&d=CwMCaQ&c=C3yme8gMkxg_ihJNXS06ZyWk4EJm8LdrrvxQb-Je7sw&r=RIEFIUIh4wnoEZFOB_TUkr8FKyuRjnDRS3tlTglKEgo&m=xOV2YjFuxkh1VpNGIGich7NwzmOVNJlK3LRmnwvu2FQ&s=iOz4KXKSttCVkYo4lDJE6ONt-GmFnBzqK_PwuDBCw88&e=

[lindenb]

yes more please ! :-)
I would be interested in the Hit containing the error (may be it's the first Hit ?)

[heh30]

This is not a very large file we’re using to test with. Here it is in its entirety. Thank you so much for your prompt response and assistance.

blastn blastn 2.2.24 [Aug-08-2010] ~Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, ~Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), ~"Gapped BLAST and PSI-BLAST: a new generation of protein database search~programs", Nucleic Acids Res. 25:3389-3402. Prunus_persica_v2.0.a1_scaffolds.fasta.Pp01 lcl|1_0 scaffold_1:46694924 203 1e-06 1 -3 5 2 F 1 lcl|1_0 scaffold_1:46694924 203 1 gnl|BL_ORD_ID|0 Pp01 0 47851208 1 400.248 201 2.9023e-111 203 1 43120809 43121011 1 -1 202 202 203 CAAATGGTTCGACGATGTAGTGGCTGCTGGCTTGAGGGAACCAAATGCTATGGCCTTGTCAACTGCTAGCAAGAATGGAAAACCGTAATATCTGTTTCCTTYGTTACTATGCATCTTTTATTAATACTAAGCTATGTTTCACATATTGTTCTTGCATGTTAGATGAAATTTTATTGGTTTCACTATAGTTTCTAAATTTCTTT CAAATGGTTCGACGATGTAGTGGCTGCTGGCTTGAGGGAACCAAATGCTATGGCCTTGTCAACTGCTAGCAAGAATGGAAAACCGTAATATCTGTTTCCTTCGTTACTATGCATCTTTTATTAATACTAAGCTATGTTTCACATATTGTTCTTGCATGTTAGATGAAATTTTATTGGTTTCACTATAGTTTCTAAATTTCTTT ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 1 47851208 0 0 0.7113 1.37856 1.31082 2 lcl|2_0 scaffold_1:42975469 203 1 gnl|BL_ORD_ID|0 Pp01 0 47851208 1 400.248 201 2.9023e-111 203 1 46840557 46840759 1 -1 202 202 203 GTCCCAATTAGCATCCAACAACTAGTTTATTACCAGTCATGTAAGCTCTCAATTTATTTCACTTATACTAATTAAAAGGCATAGTTAATTGATAGCAGCACYGAAAAAGGTACACACAGAAAGCAGTGTGTTAAATGCAACTTACCCTCAGAGGACTTGATGATGACAAAGCATAATCTTTTTCAAGATCATCAGAAAGAATA GTCCCAATTAGCATCCAACAACTAGTTTATTACCAGTCATGTAAGCTCTCAATTTATTTCACTTATACTAATTAAAAGGCATAGTTAATTGATAGCAGCACCGAAAAAGGTACACACAGAAAGCAGTGTGTTAAATGCAACTTACCCTCAGAGGACTTGATGATGACAAAGCATAATCTTTTTCAAGATCATCAGAAAGAATA ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 1 47851208 0 0 0.7113 1.37856 1.31082 3 lcl|3_0 scaffold_1:14849516 203 1 gnl|BL_ORD_ID|0 Pp01 0 47851208 1 400.248 201 2.9023e-111 1 203 15823716 15823918 1 1 202 202 203 AGAAACATCATGTCTGAATCGGATCATCAATCCCCTGCTTTTACCTCCCCAAAAATGGTGGTCAAGAAGATCCTCGCCAAGTCCCAATCTGAGGGCGATGGYGCTACTGTCAGGAGAGCCATTGGAAGGTTTGGTTCATGGTTTTTTGCCCATTTGATATTTTTTTCATATTTCCTCTGCTCTGTTTTGGGATTTCAAATCCT AGAAACATCATGTCTGAATCGGATCATCAATCCCCTGCTTTTACCTCCCCAAAAATGGTGGTCAAGAAGATCCTCGCCAAGTCCCAATCTGAGGGCGATGGCGCTACTGTCAGGAGAGCCATTGGAAGGTTTGGTTCATGGTTTTTTGCCCATTTGATATTTTTTTCATATTTCCTCTGCTCTGTTTTGGGATTTCAAATCCT ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 1 47851208 0 0 0.7113 1.37856 1.31082 4 lcl|4_0 scaffold_1:8783331 203 1 gnl|BL_ORD_ID|0 Pp01 0 47851208 1 400.248 201 2.9023e-111 1 203 9232590 9232792 1 1 202 202 203 CATTTATATCACCAAACAACGTAAACAAAACAAAATAGAGGATCAATTTTTCCTCGAGGACATCAAAACCCGGGGAAATTTCAAATACGGACAAGAAATGGRATCCCAGAAAAGGAACCAAACAGCGGATCTCGTAATCGATGGCTGTTAGTTGGAGGGTCAACCGGAAATAGTAGAAGGAGAGGAATTGGAGTTTACCTGTG CATTTATATCACCAAACAACGTAAACAAAACAAAATAGAGGATCAATTTTTCCTCGAGGACATCAAAACCCGGGGAAATTTCAAATACGGACAAGAAATGGGATCCCAGAAAAGGAACCAAACAGCGGATCTCGTAATCGATGGCTGTTAGTTGGAGGGTCAACCGGAAATAGTAGAAGGAGAGGAATTGGAGTTTACCTGTG ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 1 47851208 0 0 0.7113 1.37856 1.31082

Regards,
Heidi

From: Pierre Lindenbaum [mailto:notifications@github.com]
Sent: Wednesday, May 4, 2016 8:17 AM
To: lindenb/jvarkit jvarkit@noreply.github.com
Cc: Hough, Heidi heidi.hough@wsu.edu; Author author@noreply.github.com
Subject: Re: [lindenb/jvarkit] boum ### vs ### error when running blastn2snp (#51)

yes more please ! :-)
I would be interested in the Hit containing the error (may be it's the first Hit ?)

—
You are receiving this because you authored the thread.
Reply to this email directly or view it on GitHubhttps://urldefense.proofpoint.com/v2/url?u=https-3A__github.com_lindenb_jvarkit_issues_51-23issuecomment-2D216898072&d=CwMCaQ&c=C3yme8gMkxg_ihJNXS06ZyWk4EJm8LdrrvxQb-Je7sw&r=RIEFIUIh4wnoEZFOB_TUkr8FKyuRjnDRS3tlTglKEgo&m=CMVCDTSm1oIve3ISa1msVDWqIoOy9cElmBaXGbJ5dkI&s=PIQvnBcp5fq6n82AaOxxbf-hwCKBu12-55ARy5rjC8E&e=

[heh30]

Hello Pierre

My researcher says she’s resolved the problem. The file we had been using was generated using Blastall. She created a new one using Blast+. Is there specific software that should be used? Is Blast+ the only format that is correct for use with blastn2snp? Are there others? What are they?

Regards,
Heidi

From: Pierre Lindenbaum [mailto:notifications@github.com]
Sent: Wednesday, May 4, 2016 8:17 AM
To: lindenb/jvarkit jvarkit@noreply.github.com
Cc: Hough, Heidi heidi.hough@wsu.edu; Author author@noreply.github.com
Subject: Re: [lindenb/jvarkit] boum ### vs ### error when running blastn2snp (#51)

yes more please ! :-)
I would be interested in the Hit containing the error (may be it's the first Hit ?)

—
You are receiving this because you authored the thread.
Reply to this email directly or view it on GitHubhttps://urldefense.proofpoint.com/v2/url?u=https-3A__github.com_lindenb_jvarkit_issues_51-23issuecomment-2D216898072&d=CwMCaQ&c=C3yme8gMkxg_ihJNXS06ZyWk4EJm8LdrrvxQb-Je7sw&r=RIEFIUIh4wnoEZFOB_TUkr8FKyuRjnDRS3tlTglKEgo&m=CMVCDTSm1oIve3ISa1msVDWqIoOy9cElmBaXGbJ5dkI&s=PIQvnBcp5fq6n82AaOxxbf-hwCKBu12-55ARy5rjC8E&e=

[lindenb]

My researcher says she’s resolved the problem. The file we had been using was generated using Blastall. She created a new one using Blast+.

cool, thanks for the information.
I've never tested the old blastall with my tools. I wouldn't be surprised if the two XML are not the using the same the schema.

Closing this issue now.